Transcript: Human NM_005967.4

Homo sapiens NGFI-A binding protein 2 (NAB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
NAB2 (4665)
Length:
2491
CDS:
159..1736

Additional Resources:

NCBI RefSeq record:
NM_005967.4
NBCI Gene record:
NAB2 (4665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005967.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019547 CCTCTCGCAGAGTTCGAGGAA pLKO.1 1617 CDS 100% 0.880 1.232 N NAB2 n/a
2 TRCN0000218213 ATCCCTGCTAAAGCTGAATAA pLKO_005 953 CDS 100% 13.200 9.240 N NAB2 n/a
3 TRCN0000230291 TGAGGGACAACACGCTCTTAT pLKO_005 1150 CDS 100% 13.200 9.240 N NAB2 n/a
4 TRCN0000230292 ACACACTCCCATTCTCTTTAG pLKO_005 2021 3UTR 100% 10.800 7.560 N NAB2 n/a
5 TRCN0000019544 CCGCAAATACAGCATCATCTA pLKO.1 1043 CDS 100% 4.950 3.465 N NAB2 n/a
6 TRCN0000019548 CAGCATCATCTATGGCCGTTT pLKO.1 1052 CDS 100% 4.050 2.835 N NAB2 n/a
7 TRCN0000019545 CCTTTCCTACTATGAGACCTT pLKO.1 320 CDS 100% 2.640 1.848 N NAB2 n/a
8 TRCN0000230289 GGAAGAGGAGATCCGCAAATA pLKO_005 1031 CDS 100% 13.200 7.920 N NAB2 n/a
9 TRCN0000019546 CCACTGAAGAAGCTGAAACAA pLKO.1 1278 CDS 100% 5.625 3.375 N NAB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005967.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01061 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01061 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478859 AACACTGAAAAGTCTAGAGTCACT pLX_317 24.5% 100% 100% V5 n/a
4 ccsbBroadEn_10987 pDONR223 100% 44.3% 39.5% None (many diffs) n/a
5 ccsbBroad304_10987 pLX_304 0% 44.3% 39.5% V5 (many diffs) n/a
6 TRCN0000480603 ATTATGCCGACGGACTCCCCGATA pLX_317 60.2% 44.3% 39.5% V5 (many diffs) n/a
Download CSV