Transcript: Human NM_006156.3

Homo sapiens NEDD8 ubiquitin like modifier (NEDD8), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NEDD8 (4738)
Length:
616
CDS:
101..346

Additional Resources:

NCBI RefSeq record:
NM_006156.3
NBCI Gene record:
NEDD8 (4738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006497 GCTCATAATGAGGCATCATAT pLKO.1 378 3UTR 100% 13.200 9.240 N NEDD8 n/a
2 TRCN0000342374 GCTCATAATGAGGCATCATAT pLKO_005 378 3UTR 100% 13.200 9.240 N NEDD8 n/a
3 TRCN0000006500 CAGCAGCTGATTACAAGATTT pLKO.1 264 CDS 100% 13.200 6.600 Y NEDD8 n/a
4 TRCN0000342420 CAGCAGCTGATTACAAGATTT pLKO_005 264 CDS 100% 13.200 6.600 Y NEDD8 n/a
5 TRCN0000006498 GAAAGGAGATTGAGATTGACA pLKO.1 129 CDS 100% 3.000 1.500 Y NEDD8 n/a
6 TRCN0000342418 GAAAGGAGATTGAGATTGACA pLKO_005 129 CDS 100% 3.000 1.500 Y NEDD8 n/a
7 TRCN0000006499 GCAAGCAGATGAATGATGAGA pLKO.1 240 CDS 100% 3.000 1.500 Y NEDD8 n/a
8 TRCN0000006501 CCTACAGACAAGGTGGAGCGA pLKO.1 155 CDS 100% 0.220 0.110 Y NEDD8 n/a
9 TRCN0000342419 CCTACAGACAAGGTGGAGCGA pLKO_005 155 CDS 100% 0.220 0.110 Y NEDD8 n/a
10 TRCN0000284921 CAGCAGCTGATTACAAGATTC pLKO_005 264 CDS 100% 10.800 5.400 Y Nedd8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01082 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01082 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491483 CATGTCGAAACAGCCTCAAGAGAT pLX_317 100% 100% 100% V5 n/a
Download CSV