Transcript: Human NM_006172.4

Homo sapiens natriuretic peptide A (NPPA), mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
NPPA (4878)
Length:
855
CDS:
100..555

Additional Resources:

NCBI RefSeq record:
NM_006172.4
NBCI Gene record:
NPPA (4878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006172.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156234 CAGAGCTAATCCCATGTACAA pLKO.1 168 CDS 100% 4.950 6.930 N NPPA n/a
2 TRCN0000158014 CCTTTAGAAGATGAGGTCGTG pLKO.1 253 CDS 100% 2.160 3.024 N NPPA n/a
3 TRCN0000156456 CGCAGACCTGATGGATTTCAA pLKO.1 201 CDS 100% 5.625 3.938 N NPPA n/a
4 TRCN0000158273 CCAGAGCTAATCCCATGTACA pLKO.1 167 CDS 100% 4.950 3.465 N NPPA n/a
5 TRCN0000151808 CTGCATTTGTGTCATCTTGTT pLKO.1 633 3UTR 100% 4.950 3.465 N NPPA n/a
6 TRCN0000155038 GAATTTGCTGGACCATTTGGA pLKO.1 222 CDS 100% 3.000 2.100 N NPPA n/a
7 TRCN0000158400 CATGTACAATGCCGTGTCCAA pLKO.1 180 CDS 100% 2.640 1.848 N NPPA n/a
8 TRCN0000154839 GATGCCTTTAGAAGATGAGGT pLKO.1 249 CDS 100% 2.640 1.848 N NPPA n/a
9 TRCN0000150540 GTCAACACTTCTCACATCTTA pLKO.1 695 3UTR 100% 5.625 3.375 N NPPA n/a
10 TRCN0000154738 GCTGCATTTGTGTCATCTTGT pLKO.1 632 3UTR 100% 4.950 2.970 N NPPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006172.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06656 pDONR223 100% 98.6% 98.6% None 453_454insCGAAGA n/a
2 ccsbBroad304_06656 pLX_304 0% 98.6% 98.6% V5 453_454insCGAAGA n/a
3 TRCN0000471441 ATACACAAGCTCGTTACTATTCCT pLX_317 49.3% 98.4% 56.1% V5 (not translated due to prior stop codon) 237delG;453_454insCGAAGA n/a
Download CSV