Transcript: Human NM_006198.3

Homo sapiens Purkinje cell protein 4 (PCP4), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PCP4 (5121)
Length:
534
CDS:
65..253

Additional Resources:

NCBI RefSeq record:
NM_006198.3
NBCI Gene record:
PCP4 (5121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142911 CCATTCAGTCTCAGTTCAGAA pLKO.1 198 CDS 100% 4.950 3.960 N PCP4 n/a
2 TRCN0000143927 CAACCATCATCTGTCAAGAAA pLKO.1 294 3UTR 100% 5.625 3.938 N PCP4 n/a
3 TRCN0000122167 GATGGACAGAAGAAAGTTCAA pLKO.1 125 CDS 100% 4.950 3.465 N PCP4 n/a
4 TRCN0000143519 GCATGTACAGAAACCTGTGAT pLKO.1 383 3UTR 100% 4.950 3.465 N PCP4 n/a
5 TRCN0000121876 GAAGAATTTGACATTGACATG pLKO.1 146 CDS 100% 4.050 2.835 N PCP4 n/a
6 TRCN0000141737 GCATAGCAAACCTCCAATGCA pLKO.1 365 3UTR 100% 3.000 2.100 N PCP4 n/a
7 TRCN0000142558 GCCATTCAGTCTCAGTTCAGA pLKO.1 197 CDS 100% 3.000 2.100 N PCP4 n/a
8 TRCN0000121695 CAGAAGAAAGTTCAAGAAGAA pLKO.1 131 CDS 100% 4.950 2.970 N PCP4 n/a
9 TRCN0000145050 CATGTACAGAAACCTGTGATA pLKO.1 384 3UTR 100% 4.950 2.970 N PCP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01154 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01154 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468848 TGAGTGTGCCCTCCTCGTCATATT pLX_317 100% 100% 100% V5 n/a
Download CSV