Transcript: Human NM_006240.2

Homo sapiens protein phosphatase with EF-hand domain 1 (PPEF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PPEF1 (5475)
Length:
2873
CDS:
482..2443

Additional Resources:

NCBI RefSeq record:
NM_006240.2
NBCI Gene record:
PPEF1 (5475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006240.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002551 CGAGGAGCTTACATCAAACTA pLKO.1 1781 CDS 100% 5.625 7.875 N PPEF1 n/a
2 TRCN0000081222 GTCTTAGAGGTGCTATTTGAA pLKO.1 896 CDS 100% 5.625 7.875 N LOC436244 n/a
3 TRCN0000367462 AGATACTTCATGCCCATTATG pLKO_005 876 CDS 100% 13.200 10.560 N PPEF1 n/a
4 TRCN0000002550 GCTAGGCCCAAATCACAAGTA pLKO.1 2480 3UTR 100% 4.950 3.960 N PPEF1 n/a
5 TRCN0000356062 GATGTCCCAGACTCCTATAAT pLKO_005 785 CDS 100% 15.000 10.500 N PPEF1 n/a
6 TRCN0000367459 CAATAAGCTTGCCAACATAAT pLKO_005 2314 CDS 100% 13.200 9.240 N PPEF1 n/a
7 TRCN0000356063 CCTCTCACTTGTACGGATATT pLKO_005 824 CDS 100% 13.200 9.240 N PPEF1 n/a
8 TRCN0000002548 GATCTCCTACTGAACACTTAA pLKO.1 1506 CDS 100% 13.200 9.240 N PPEF1 n/a
9 TRCN0000002547 CGGCTACAATTTCCTCTCACT pLKO.1 812 CDS 100% 2.640 1.848 N PPEF1 n/a
10 TRCN0000002549 GTGACTTTGTAGATCGAGGAA pLKO.1 1080 CDS 100% 2.640 1.584 N PPEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006240.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01251 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01251 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471955 CGGGGTTCAATCGCGGAGGTGCTC pLX_317 15.8% 100% 100% V5 n/a
Download CSV