Transcript: Human NM_006248.4

Homo sapiens proline rich protein BstNI subfamily 2 (PRB2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
PRB2 (653247)
Length:
1431
CDS:
39..1289

Additional Resources:

NCBI RefSeq record:
NM_006248.4
NBCI Gene record:
PRB2 (653247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006248.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078008 CCCTCCCTAATAGCAGGAAAT pLKO.1 123 CDS 100% 10.800 5.400 Y PRB1 n/a
2 TRCN0000183583 GAATAAGAAGATGAGAGTGAT pLKO.1 1328 3UTR 100% 4.950 2.475 Y PRB2 n/a
3 TRCN0000147897 GATTCAATGACAGGAAGTGAA pLKO.1 1310 3UTR 100% 4.950 2.475 Y PRB2 n/a
4 TRCN0000078009 GCTCAGAACTTAAATGAAGAT pLKO.1 84 CDS 100% 4.950 2.475 Y PRB1 n/a
5 TRCN0000078012 AGGAAGAATCTCCCTCCCTAA pLKO.1 112 CDS 100% 4.050 2.025 Y PRB1 n/a
6 TRCN0000373239 AGGAGGCAACAAACCTCAAGG pLKO_005 164 CDS 100% 4.050 2.025 Y PRB3 n/a
7 TRCN0000373238 ATGAAGATGTCAGCCAGGAAG pLKO_005 97 CDS 100% 4.050 2.025 Y PRB3 n/a
8 TRCN0000078010 CAAGAAGGCAACAATCCTCAA pLKO.1 1152 CDS 100% 4.050 2.025 Y PRB1 n/a
9 TRCN0000078011 CAAGGAGGCAACAAACCTCAA pLKO.1 162 CDS 100% 4.050 2.025 Y PRB1 n/a
10 TRCN0000021927 TCTAGGATTCAATGACAGGAA pLKO.1 1305 3UTR 100% 2.640 1.320 Y PRB4 n/a
11 TRCN0000146707 CTTAAATGAAGATGTCAGCCA pLKO.1 92 CDS 100% 0.660 0.330 Y PRB2 n/a
12 TRCN0000021924 CAGGAAGTGAATAAGAAGATA pLKO.1 1320 3UTR 100% 5.625 2.813 Y PRB4 n/a
13 TRCN0000154500 GAAGATGTCAGCCAGGAAGAT pLKO.1 99 CDS 100% 4.950 2.475 Y PRH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006248.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06764 pDONR223 100% 64.4% 59.1% None (many diffs) n/a
2 ccsbBroad304_06764 pLX_304 0% 64.4% 59.1% V5 (many diffs) n/a
3 TRCN0000469220 CAAGGACAGTGCATGGTCCCCGAC pLX_317 16.1% 64.4% 59.1% V5 (many diffs) n/a
4 TRCN0000465570 AAGTGGGAGAGTAAGTGCCTGGTC pLX_317 83.2% 19.2% 17.2% V5 (many diffs) n/a
5 ccsbBroadEn_06763 pDONR223 100% 46.7% 46.1% None (many diffs) n/a
6 ccsbBroad304_06763 pLX_304 0% 46.7% 46.1% V5 (many diffs) n/a
Download CSV