Transcript: Human NM_006249.5

Homo sapiens proline rich protein BstNI subfamily 3 (PRB3), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PRB3 (5544)
Length:
1101
CDS:
39..968

Additional Resources:

NCBI RefSeq record:
NM_006249.5
NBCI Gene record:
PRB3 (5544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006249.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078014 CCCTCCGTAATATCAGGAAAG pLKO.1 123 CDS 100% 6.000 4.200 N PRB3 n/a
2 TRCN0000078017 CCTTCACAAGGAGGCAACAAA pLKO.1 723 CDS 100% 5.625 3.938 N PRB3 n/a
3 TRCN0000078013 GAAGGTAACAAACCTCAACGT pLKO.1 795 CDS 100% 2.640 1.848 N PRB3 n/a
4 TRCN0000078015 CCAGAAGGACCACCTTCACAA pLKO.1 711 CDS 100% 0.495 0.347 N PRB3 n/a
5 TRCN0000373290 GAAGAATCTCCCTCCGTAATA pLKO_005 114 CDS 100% 13.200 7.920 N PRB3 n/a
6 TRCN0000078016 GCTCAGAGCTTAAATGAAGAT pLKO.1 84 CDS 100% 4.950 2.970 N PRB3 n/a
7 TRCN0000373239 AGGAGGCAACAAACCTCAAGG pLKO_005 731 CDS 100% 4.050 2.025 Y PRB3 n/a
8 TRCN0000373238 ATGAAGATGTCAGCCAGGAAG pLKO_005 97 CDS 100% 4.050 2.025 Y PRB3 n/a
9 TRCN0000078011 CAAGGAGGCAACAAACCTCAA pLKO.1 729 CDS 100% 4.050 2.025 Y PRB1 n/a
10 TRCN0000146707 CTTAAATGAAGATGTCAGCCA pLKO.1 92 CDS 100% 0.660 0.330 Y PRB2 n/a
11 TRCN0000154500 GAAGATGTCAGCCAGGAAGAT pLKO.1 99 CDS 100% 4.950 2.475 Y PRH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006249.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06764 pDONR223 100% 99.4% 99% None (many diffs) n/a
2 ccsbBroad304_06764 pLX_304 0% 99.4% 99% V5 (many diffs) n/a
3 TRCN0000469220 CAAGGACAGTGCATGGTCCCCGAC pLX_317 16.1% 99.4% 99% V5 (many diffs) n/a
4 TRCN0000465570 AAGTGGGAGAGTAAGTGCCTGGTC pLX_317 83.2% 27.1% 24.5% V5 (many diffs) n/a
5 ccsbBroadEn_06763 pDONR223 100% 57.6% 50.1% None (many diffs) n/a
6 ccsbBroad304_06763 pLX_304 0% 57.6% 50.1% V5 (many diffs) n/a
Download CSV