Transcript: Human NM_006281.4

Homo sapiens serine/threonine kinase 3 (STK3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
STK3 (6788)
Length:
2833
CDS:
149..1624

Additional Resources:

NCBI RefSeq record:
NM_006281.4
NBCI Gene record:
STK3 (6788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006281.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380687 AGAACTACAGATGCGGTTAAA pLKO_005 1486 CDS 100% 13.200 18.480 N STK3 n/a
2 TRCN0000350498 CCGGTCAAGTTGTCGCAATTA pLKO_005 294 CDS 100% 13.200 18.480 N STK3 n/a
3 TRCN0000315194 GTCCGATGATTTCACCGATTT pLKO_005 889 CDS 100% 10.800 15.120 N STK3 n/a
4 TRCN0000195220 CAAACTGTAATAAGCTCATCA pLKO.1 2480 3UTR 100% 4.950 6.930 N STK3 n/a
5 TRCN0000002177 CGGATGAAGATGAGCTGGATT pLKO.1 1095 CDS 100% 4.950 6.930 N STK3 n/a
6 TRCN0000315193 CGGATGAAGATGAGCTGGATT pLKO_005 1095 CDS 100% 4.950 6.930 N STK3 n/a
7 TRCN0000315195 TCTAGTATACTAGGCTATTTA pLKO_005 1984 3UTR 100% 15.000 10.500 N STK3 n/a
8 TRCN0000195190 CTGGAAATATTCTCCTCAATA pLKO.1 594 CDS 100% 13.200 9.240 N STK3 n/a
9 TRCN0000002173 GTCATTTCCTAAGCTACATAT pLKO.1 2725 3UTR 100% 13.200 9.240 N STK3 n/a
10 TRCN0000315260 TACATCCAATGAGGGCTATTT pLKO_005 819 CDS 100% 13.200 9.240 N STK3 n/a
11 TRCN0000381880 CCATGATGGAACGGGAGATAG pLKO_005 1518 CDS 100% 10.800 7.560 N STK3 n/a
12 TRCN0000380071 TGATTCAAGAAATAGGCTATA pLKO_005 723 CDS 100% 10.800 7.560 N STK3 n/a
13 TRCN0000002175 GAATGCCAAACCTGTATCAAT pLKO.1 985 CDS 100% 5.625 3.938 N STK3 n/a
14 TRCN0000002176 CCACAAATCCACCACCAACAT pLKO.1 849 CDS 100% 4.950 3.465 N STK3 n/a
15 TRCN0000002174 GCAATACACAAGGAATCCGGT pLKO.1 278 CDS 100% 0.660 0.462 N STK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006281.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14850 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14850 pLX_304 20.5% 100% 100% V5 n/a
3 TRCN0000470542 TGTCTGCAAGTCTCTCTATTTCCC pLX_317 26.5% 100% 100% V5 n/a
4 TRCN0000491248 TCAACTCTAATCTCTCTTATATGC pLX_317 13.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488127 AACTCAATGCCCTACCTTGTAGCA pLX_317 20.6% 99.9% 99.7% V5 1473_1474insG n/a
6 ccsbBroadEn_07012 pDONR223 100% 99.9% 99.7% None 10C>A n/a
7 ccsbBroad304_07012 pLX_304 20.5% 99.9% 99.7% V5 10C>A n/a
8 TRCN0000475289 ACCGACTTGTTGACGCTCCGTCAA pLX_317 20.2% 99.9% 99.7% V5 10C>A n/a
Download CSV