Transcript: Human NM_006319.5

Homo sapiens CDP-diacylglycerol--inositol 3-phosphatidyltransferase (CDIPT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CDIPT (10423)
Length:
1843
CDS:
370..1011

Additional Resources:

NCBI RefSeq record:
NM_006319.5
NBCI Gene record:
CDIPT (10423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006319.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035985 CGGATTGTCTTCGCCATCATT pLKO.1 421 CDS 100% 5.625 7.875 N CDIPT n/a
2 TRCN0000333189 CGGATTGTCTTCGCCATCATT pLKO_005 421 CDS 100% 5.625 7.875 N CDIPT n/a
3 TRCN0000035984 CGCCATCATTTCTTTCTACTT pLKO.1 432 CDS 100% 4.950 6.930 N CDIPT n/a
4 TRCN0000333271 CGCCATCATTTCTTTCTACTT pLKO_005 432 CDS 100% 4.950 6.930 N CDIPT n/a
5 TRCN0000035988 CTCGCGCTCTTAATCAAGGAA pLKO.1 530 CDS 100% 3.000 4.200 N CDIPT n/a
6 TRCN0000333272 CTCGCGCTCTTAATCAAGGAA pLKO_005 530 CDS 100% 3.000 4.200 N CDIPT n/a
7 TRCN0000035987 GAGTCACAAGATGATCGACTT pLKO.1 723 CDS 100% 4.050 3.240 N CDIPT n/a
8 TRCN0000333273 GAGTCACAAGATGATCGACTT pLKO_005 723 CDS 100% 4.050 3.240 N CDIPT n/a
9 TRCN0000035986 CTTCCAAATCAGCATGAGTTT pLKO.1 648 CDS 100% 4.950 3.465 N CDIPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006319.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02425 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02425 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468452 TTGCTATTACCCGTTAAAAGCTTC pLX_317 58.5% 100% 100% V5 n/a
Download CSV