Transcript: Human NM_006327.4

Homo sapiens translocase of inner mitochondrial membrane 23 (TIMM23), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TIMM23 (100287932)
Length:
1190
CDS:
137..766

Additional Resources:

NCBI RefSeq record:
NM_006327.4
NBCI Gene record:
TIMM23 (100287932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006327.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233016 CCAGCCTCTATGCACTATATA pLKO_005 699 CDS 100% 15.000 21.000 N TIMM23 n/a
2 TRCN0000233015 GGTCTGACAGGACTAACACTT pLKO_005 677 CDS 100% 4.950 6.930 N TIMM23 n/a
3 TRCN0000233018 CTTCTACCTACAATTAGTTTG pLKO_005 848 3UTR 100% 10.800 7.560 N TIMM23 n/a
4 TRCN0000233014 ACAGGTGGTCTTCGAGGGATA pLKO_005 647 CDS 100% 4.050 2.835 N TIMM23 n/a
5 TRCN0000233017 GAGCACATGAAAGGCTCCTTG pLKO_005 728 CDS 100% 4.050 2.835 N TIMM23 n/a
6 TRCN0000114247 GCCTGGTCCAAACCAAGAAAT pLKO.1 455 CDS 100% 13.200 7.920 N Timm23 n/a
7 TRCN0000180093 CCTTTGGTGACTCACTGAGTA pLKO.1 963 3UTR 100% 4.950 2.970 N TIMM23 n/a
8 TRCN0000178920 CCTTCTTTACGATTGGAGGAT pLKO.1 363 CDS 100% 2.640 1.320 Y TIMM23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006327.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02428 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02428 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_11498 pDONR223 100% 99.5% 99.5% None 182_184delTTT n/a
4 ccsbBroad304_11498 pLX_304 0% 99.5% 99.5% V5 182_184delTTT n/a
5 TRCN0000471893 GGGCTAAATTTTAGCTTGGTCAGC pLX_317 74.2% 99.5% 99.5% V5 182_184delTTT n/a
Download CSV