Transcript: Human NM_006335.3

Homo sapiens translocase of inner mitochondrial membrane 17A (TIMM17A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TIMM17A (10440)
Length:
1650
CDS:
25..540

Additional Resources:

NCBI RefSeq record:
NM_006335.3
NBCI Gene record:
TIMM17A (10440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146561 CTTTAATTGAAGGAGCTGGTA pLKO.1 395 CDS 100% 2.640 3.696 N TIMM17A n/a
2 TRCN0000149047 GCTGGTATCTTGTTGACAAGA pLKO.1 409 CDS 100% 0.495 0.693 N TIMM17A n/a
3 TRCN0000275956 GCTGGTATCTTGTTGACAAGA pLKO_005 409 CDS 100% 0.495 0.693 N TIMM17A n/a
4 TRCN0000275906 GGGAGTTTGACAGCTATTAAA pLKO_005 172 CDS 100% 15.000 12.000 N TIMM17A n/a
5 TRCN0000149081 GCACTGGAAGAGTTTAGTGTT pLKO.1 1274 3UTR 100% 4.950 3.960 N TIMM17A n/a
6 TRCN0000275898 GCACTGGAAGAGTTTAGTGTT pLKO_005 1274 3UTR 100% 4.950 3.960 N TIMM17A n/a
7 TRCN0000149501 GTATGGTTCAAGTCAGAGGAA pLKO.1 260 CDS 100% 2.640 2.112 N TIMM17A n/a
8 TRCN0000275953 GTATGGTTCAAGTCAGAGGAA pLKO_005 260 CDS 100% 2.640 2.112 N TIMM17A n/a
9 TRCN0000149269 GCACTTCAGAACAGGTCATTT pLKO.1 1398 3UTR 100% 13.200 9.240 N TIMM17A n/a
10 TRCN0000275963 TTTGGAGACTATCGACAATAT pLKO_005 514 CDS 100% 13.200 9.240 N TIMM17A n/a
11 TRCN0000114227 CCATGGCGAATTGTGGATGAT pLKO.1 52 CDS 100% 4.950 2.475 Y Timm17b n/a
12 TRCN0000180133 CCATGGCGAATTGTGGATGAT pLKO.1 52 CDS 100% 4.950 2.475 Y TIMM17B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02434 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02434 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471977 ATGACTGTGTTAGGCGGCTCACGG pLX_317 85.1% 100% 100% V5 n/a
Download CSV