Transcript: Human NM_006362.5

Homo sapiens nuclear RNA export factor 1 (NXF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NXF1 (10482)
Length:
2290
CDS:
85..1944

Additional Resources:

NCBI RefSeq record:
NM_006362.5
NBCI Gene record:
NXF1 (10482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006362.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435088 ACGATGATGAACGCGTTAATT pLKO_005 116 CDS 100% 15.000 21.000 N NXF1 n/a
2 TRCN0000011092 CGCGAACGATTTCCCAAGTTA pLKO.1 1108 CDS 100% 5.625 7.875 N NXF1 n/a
3 TRCN0000007580 CCCTGTAAATAGTCCTTGGAT pLKO.1 1972 3UTR 100% 3.000 4.200 N NXF1 n/a
4 TRCN0000420330 CATTGAAGGCTGTCAACTATA pLKO_005 596 CDS 100% 13.200 9.240 N NXF1 n/a
5 TRCN0000421912 GAAGCAGCTTAGCCGAGTATT pLKO_005 1370 CDS 100% 13.200 9.240 N NXF1 n/a
6 TRCN0000007583 GCGGGAATTGGACAAGATAAA pLKO.1 1002 CDS 100% 13.200 9.240 N NXF1 n/a
7 TRCN0000007581 CCAGTTCTGAAGAGATCCAAA pLKO.1 1700 CDS 100% 4.950 3.465 N NXF1 n/a
8 TRCN0000007582 CCGAAGGATATCTATCATCAT pLKO.1 636 CDS 100% 4.950 3.465 N NXF1 n/a
9 TRCN0000413368 TCAGAAGATTGAGCCTCACTG pLKO_005 2110 3UTR 100% 4.050 2.835 N NXF1 n/a
10 TRCN0000436264 CAACAGTACTATGCAATTTAC pLKO_005 1258 CDS 100% 13.200 7.920 N NXF1 n/a
11 TRCN0000102267 GCGAACGATTTCCCAAGTTAT pLKO.1 1109 CDS 100% 13.200 18.480 N Nxf1 n/a
12 TRCN0000287244 GCGAACGATTTCCCAAGTTAT pLKO_005 1109 CDS 100% 13.200 18.480 N Nxf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006362.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02452 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02452 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469046 CCACTGTAACTGATTCTGACATGC pLX_317 23.1% 100% 100% V5 n/a
Download CSV