Transcript: Human NM_006432.4

Homo sapiens NPC intracellular cholesterol transporter 2 (NPC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NPC2 (10577)
Length:
1033
CDS:
239..694

Additional Resources:

NCBI RefSeq record:
NM_006432.4
NBCI Gene record:
NPC2 (10577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006432.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029320 CCAGTACAGATCGTTTCTCAT pLKO.1 668 CDS 100% 4.950 6.930 N NPC2 n/a
2 TRCN0000293238 TGTCACCTTCACCAGCAATAT pLKO_005 412 CDS 100% 13.200 9.240 N NPC2 n/a
3 TRCN0000029319 CCTGAATAAACTACCAGTGAA pLKO.1 565 CDS 100% 4.950 3.465 N NPC2 n/a
4 TRCN0000029321 GCTGAGCAAAGGACAGTCTTA pLKO.1 382 CDS 100% 4.950 3.465 N NPC2 n/a
5 TRCN0000293236 GCTGAGCAAAGGACAGTCTTA pLKO_005 382 CDS 100% 4.950 3.465 N NPC2 n/a
6 TRCN0000029322 TGATGGTTGTAAGAGTGGAAT pLKO.1 508 CDS 100% 4.950 3.465 N NPC2 n/a
7 TRCN0000293235 TGATGGTTGTAAGAGTGGAAT pLKO_005 508 CDS 100% 4.950 3.465 N NPC2 n/a
8 TRCN0000029323 CGGTTCTGTGGATGGAGTTAT pLKO.1 319 CDS 100% 13.200 7.920 N NPC2 n/a
9 TRCN0000293234 CGGTTCTGTGGATGGAGTTAT pLKO_005 319 CDS 100% 13.200 7.920 N NPC2 n/a
10 TRCN0000293237 TCCAATGGTATCCAGTGATTC pLKO_005 789 3UTR 100% 10.800 5.400 Y NPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006432.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02475 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02475 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475027 TGCTAGCTTGATCTCTATCTACTA pLX_317 90.2% 100% 100% V5 n/a
Download CSV