Transcript: Human NM_006499.4

Homo sapiens galectin 8 (LGALS8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
LGALS8 (3964)
Length:
6281
CDS:
382..1461

Additional Resources:

NCBI RefSeq record:
NM_006499.4
NBCI Gene record:
LGALS8 (3964)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006499.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057353 CGCCTGAATATTAAAGCATTT pLKO.1 1204 CDS 100% 10.800 15.120 N LGALS8 n/a
2 TRCN0000419213 TATCATCTATAACCCGGTAAT pLKO_005 411 CDS 100% 10.800 8.640 N LGALS8 n/a
3 TRCN0000057356 GAGCAAAGATTCGACTGTCAA pLKO.1 987 CDS 100% 4.950 3.960 N LGALS8 n/a
4 TRCN0000435504 TATGGAGTACCTACTATAATA pLKO_005 1741 3UTR 100% 15.000 10.500 N LGALS8 n/a
5 TRCN0000419140 GGGTCCTCTGGGATTAGTTAT pLKO_005 1931 3UTR 100% 13.200 9.240 N LGALS8 n/a
6 TRCN0000416178 TATTACCTCTTTCCCATTTAG pLKO_005 1272 CDS 100% 13.200 9.240 N LGALS8 n/a
7 TRCN0000433849 TACACAGCCTGGAGTACAAAC pLKO_005 1361 CDS 100% 10.800 7.560 N LGALS8 n/a
8 TRCN0000057354 CCTGGAACTTTGATTGTGATA pLKO.1 466 CDS 100% 4.950 3.465 N LGALS8 n/a
9 TRCN0000057357 GCTGGAAATTAATGGAGACAT pLKO.1 1413 CDS 100% 4.950 3.465 N LGALS8 n/a
10 TRCN0000057355 GCAAAGTGAATATTCACTCAA pLKO.1 806 CDS 100% 0.495 0.347 N LGALS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006499.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10438 pDONR223 100% 98.8% 98.3% None (many diffs) n/a
2 ccsbBroad304_10438 pLX_304 0% 98.8% 98.3% V5 (many diffs) n/a
3 TRCN0000472443 GGTGAGATCTCTGTGTCTTCTTAT pLX_317 46.4% 98.8% 98.3% V5 (many diffs) n/a
4 ccsbBroadEn_10205 pDONR223 100% 88% 88% None 1_3delATG;550_675del n/a
5 ccsbBroad304_10205 pLX_304 0% 88% 88% V5 1_3delATG;550_675del n/a
6 TRCN0000468715 CCGGTCATATTCAGCACCATGCCT pLX_317 37.3% 88% 88% V5 1_3delATG;550_675del n/a
Download CSV