Transcript: Human NM_006529.4

Homo sapiens glycine receptor alpha 3 (GLRA3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GLRA3 (8001)
Length:
8697
CDS:
437..1831

Additional Resources:

NCBI RefSeq record:
NM_006529.4
NBCI Gene record:
GLRA3 (8001)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060900 GCCCTCCAGTTAATGTCACAT pLKO.1 636 CDS 100% 4.950 6.930 N GLRA3 n/a
2 TRCN0000425840 ACAGGAAAGTTTACGTGTATA pLKO_005 1145 CDS 100% 13.200 9.240 N GLRA3 n/a
3 TRCN0000425352 AGCGACAAATGGGATACTATC pLKO_005 1185 CDS 100% 10.800 7.560 N GLRA3 n/a
4 TRCN0000060901 GTACACAATGAATGATCTCAT pLKO.1 1015 CDS 100% 4.950 3.465 N GLRA3 n/a
5 TRCN0000060899 CCATGTCTACAAGCAAAGGAT pLKO.1 1604 CDS 100% 3.000 2.100 N GLRA3 n/a
6 TRCN0000060898 GCACTGTTACTCAGTTTGGTT pLKO.1 494 CDS 100% 3.000 2.100 N GLRA3 n/a
7 TRCN0000418195 TTCTACTGGGTTATCTATAAA pLKO_005 1772 CDS 100% 15.000 9.000 N GLRA3 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7041 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7042 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6207 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07194 pDONR223 100% 99.7% 100% None 822A>G;876T>C;1080T>C n/a
2 ccsbBroad304_07194 pLX_304 0% 99.7% 100% V5 822A>G;876T>C;1080T>C n/a
3 TRCN0000473127 ACCTTGACTCCTCTATATGGAAAT pLX_317 28.8% 99.7% 100% V5 822A>G;876T>C;1080T>C n/a
Download CSV