Transcript: Human NM_006739.4

Homo sapiens minichromosome maintenance complex component 5 (MCM5), mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
MCM5 (4174)
Length:
3458
CDS:
78..2282

Additional Resources:

NCBI RefSeq record:
NM_006739.4
NBCI Gene record:
MCM5 (4174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425814 TCTACTCCATCAAGAAGTTTG pLKO_005 880 CDS 100% 10.800 15.120 N MCM5 n/a
2 TRCN0000412286 TCGCGCTTCGACATGATCTTC pLKO_005 1611 CDS 100% 4.950 6.930 N MCM5 n/a
3 TRCN0000421396 GACCCTTCGTCCCGGAATTTC pLKO_005 1338 CDS 100% 4.400 6.160 N MCM5 n/a
4 TRCN0000420069 GATGAACTCAAGCGGCATTAC pLKO_005 246 CDS 100% 10.800 8.640 N MCM5 n/a
5 TRCN0000413912 TACTCGCCGAGGAGACATCAA pLKO_005 1184 CDS 100% 4.950 3.960 N MCM5 n/a
6 TRCN0000414809 GCCAAGCTGAAGAAGTTTATT pLKO_005 1746 CDS 100% 15.000 10.500 N MCM5 n/a
7 TRCN0000433317 ACTTCATCATGCCCGACAAAT pLKO_005 712 CDS 100% 13.200 9.240 N MCM5 n/a
8 TRCN0000010517 CACGGGCTTCACCTTCAAATA pLKO.1 221 CDS 100% 13.200 9.240 N MCM5 n/a
9 TRCN0000000268 GAAACTGAAGAACCGCTACAT pLKO.1 1817 CDS 100% 4.950 3.465 N MCM5 n/a
10 TRCN0000417228 CATCCAGGTCATGCTCAAGTC pLKO_005 446 CDS 100% 4.050 2.835 N MCM5 n/a
11 TRCN0000000269 GTACTGGATTGAGGTGGAGAT pLKO.1 278 CDS 100% 4.050 2.835 N MCM5 n/a
12 TRCN0000000270 AGAGAAACTGAAGAACCGCTA pLKO.1 1814 CDS 100% 2.160 1.512 N MCM5 n/a
13 TRCN0000000267 GCACAGCATCATCAAGGACTT pLKO.1 2150 CDS 100% 4.050 2.430 N MCM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06569 pDONR223 100% 99.9% 99.8% None 122A>G n/a
2 ccsbBroad304_06569 pLX_304 0% 99.9% 99.8% V5 122A>G n/a
3 TRCN0000470025 TATACGATAGGTCATCCACTATAT pLX_317 14.5% 99.9% 99.8% V5 122A>G n/a
4 ccsbBroadEn_06570 pDONR223 100% 99.9% 100% None 831T>C;1707G>A n/a
5 ccsbBroad304_06570 pLX_304 0% 99.9% 100% V5 831T>C;1707G>A n/a
6 TRCN0000466048 TTTTAAGACAAAATGCATTTTCAT pLX_317 14.5% 99.9% 100% V5 831T>C;1707G>A n/a
Download CSV