Transcript: Human NM_006773.4

Homo sapiens DEAD-box helicase 18 (DDX18), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DDX18 (8886)
Length:
3753
CDS:
88..2100

Additional Resources:

NCBI RefSeq record:
NM_006773.4
NBCI Gene record:
DDX18 (8886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006773.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050534 CCAAGGTTCCATTAAGTGAAT pLKO.1 1718 CDS 100% 4.950 6.930 N DDX18 n/a
2 TRCN0000290732 CCAAGGTTCCATTAAGTGAAT pLKO_005 1718 CDS 100% 4.950 6.930 N DDX18 n/a
3 TRCN0000050535 CGTGCATACCTATGGCTTGAT pLKO.1 921 CDS 100% 4.950 6.930 N DDX18 n/a
4 TRCN0000290665 CGTGCATACCTATGGCTTGAT pLKO_005 921 CDS 100% 4.950 6.930 N DDX18 n/a
5 TRCN0000050533 GCCAACACGTAGACAGACTAT pLKO.1 1149 CDS 100% 4.950 6.930 N DDX18 n/a
6 TRCN0000290663 GCCAACACGTAGACAGACTAT pLKO_005 1149 CDS 100% 4.950 6.930 N DDX18 n/a
7 TRCN0000050537 CCTGGCAAGGATTTCTCTGAA pLKO.1 1206 CDS 100% 4.950 3.465 N DDX18 n/a
8 TRCN0000290662 CCTGGCAAGGATTTCTCTGAA pLKO_005 1206 CDS 100% 4.950 3.465 N DDX18 n/a
9 TRCN0000050536 GCTCTTTACATTCCTTAAGAA pLKO.1 1332 CDS 100% 5.625 3.375 N DDX18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006773.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07324 pDONR223 100% 99.9% 99.8% None 281C>G n/a
2 ccsbBroad304_07324 pLX_304 0% 99.9% 99.8% V5 281C>G n/a
3 TRCN0000479340 TTAAGGGAGGTTCCTAATAAGCGG pLX_317 22.8% 99.9% 99.7% V5 281C>G;2003T>A n/a
4 TRCN0000488316 GGGACAACGTGGCTATACCTCCAT pLX_317 15.5% 99.9% 99.8% V5 (not translated due to prior stop codon) 281C>G n/a
5 TRCN0000487989 ACACGAGTGACATTGGTGGCGATC pLX_317 11.2% 99.9% 99.7% V5 281C>G;2010_2011insG n/a
Download CSV