Transcript: Human NM_006932.5

Homo sapiens smoothelin (SMTN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SMTN (6525)
Length:
3131
CDS:
220..2973

Additional Resources:

NCBI RefSeq record:
NM_006932.5
NBCI Gene record:
SMTN (6525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006932.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439641 GCGCAAGGCCATGATTGAGAA pLKO_005 2508 CDS 100% 4.950 6.930 N SMTN n/a
2 TRCN0000437485 TTGCGAAGCGCTGGTGAGTAT pLKO_005 514 CDS 100% 4.950 6.930 N SMTN n/a
3 TRCN0000123230 GCTGAGGAGCTGATGACTATT pLKO.1 1957 CDS 100% 13.200 9.240 N SMTN n/a
4 TRCN0000123229 CCATGAACGATGTGGAGGAAT pLKO.1 482 CDS 100% 4.950 3.465 N SMTN n/a
5 TRCN0000123231 CGAGTGAACAAAGCACCAGAA pLKO.1 1918 CDS 100% 4.050 2.835 N SMTN n/a
6 TRCN0000123233 CATGATGCAAACCAAGACCTT pLKO.1 2325 CDS 100% 2.640 1.848 N SMTN n/a
7 TRCN0000123232 CCATGATGCAAACCAAGACCT pLKO.1 2324 CDS 100% 2.640 1.848 N SMTN n/a
8 TRCN0000112950 GACATGATGATCATGGGCAAA pLKO.1 2860 CDS 100% 4.050 3.240 N Smtn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006932.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13955 pDONR223 100% 97.1% 58.2% None (many diffs) n/a
2 ccsbBroad304_13955 pLX_304 0% 97.1% 58.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471502 AGCCCACGGATCGAGCTGAATATT pLX_317 2.2% 97.1% 58.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV