Transcript: Human NM_006938.4

Homo sapiens small nuclear ribonucleoprotein D1 polypeptide (SNRPD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SNRPD1 (6632)
Length:
4858
CDS:
117..476

Additional Resources:

NCBI RefSeq record:
NM_006938.4
NBCI Gene record:
SNRPD1 (6632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010937 CGCTGAGTATTCGAGGAAATA pLKO.1 286 CDS 100% 13.200 18.480 N SNRPD1 n/a
2 TRCN0000005382 CCATTGAATTGAAGAACGGAA pLKO.1 163 CDS 100% 2.640 3.696 N SNRPD1 n/a
3 TRCN0000005383 CCAGACAGTTTACCTCTGGAT pLKO.1 327 CDS 100% 0.264 0.370 N SNRPD1 n/a
4 TRCN0000123403 GATACACTACTTGTGGATGTT pLKO.1 345 CDS 100% 4.950 3.960 N Snrpd1 n/a
5 TRCN0000287520 GATACACTACTTGTGGATGTT pLKO_005 345 CDS 100% 4.950 3.960 N Snrpd1 n/a
6 TRCN0000005380 GCTGCATAGTTGAAGATTTAT pLKO.1 846 3UTR 100% 15.000 10.500 N SNRPD1 n/a
7 TRCN0000427932 AGAGCTGTCTATTTAGTATAT pLKO_005 573 3UTR 100% 13.200 9.240 N SNRPD1 n/a
8 TRCN0000434377 GTTCAGCGTTTGCCTTATTTG pLKO_005 931 3UTR 100% 13.200 9.240 N SNRPD1 n/a
9 TRCN0000295073 ATTGAGTCATGAAACTGTAAC pLKO_005 143 CDS 100% 10.800 7.560 N Snrpd1 n/a
10 TRCN0000423005 GATACAGCAACAGCCGGATTA pLKO_005 904 3UTR 100% 10.800 7.560 N SNRPD1 n/a
11 TRCN0000005381 CCTAAGGTGAAATCTAAGAAA pLKO.1 369 CDS 100% 5.625 3.938 N SNRPD1 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1837 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000295005 CGATAATGTCTCTCAAGATTA pLKO_005 471 CDS 100% 13.200 10.560 N Snrpd1 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1838 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2001 3UTR 100% 10.800 5.400 Y SMIM11A n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4445 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 415 CDS 100% 4.950 2.475 Y NPM2 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4445 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469783 GTGTCATAAGCGTCGATGCACCCT pLX_317 84% 100% 100% V5 n/a
2 ccsbBroadEn_06983 pDONR223 100% 99.7% 99.1% None 352A>T n/a
3 ccsbBroad304_06983 pLX_304 0% 99.7% 99.1% V5 352A>T n/a
Download CSV