Transcript: Human NM_007269.4

Homo sapiens syntaxin binding protein 3 (STXBP3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
STXBP3 (6814)
Length:
2489
CDS:
65..1843

Additional Resources:

NCBI RefSeq record:
NM_007269.4
NBCI Gene record:
STXBP3 (6814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007269.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158420 CGACATCAAAGTCTGTAGATT pLKO.1 312 CDS 100% 5.625 7.875 N STXBP3 n/a
2 TRCN0000162507 CGACATATTGCGGTTGTGTTA pLKO.1 947 CDS 100% 4.950 6.930 N STXBP3 n/a
3 TRCN0000160528 CCAAGGATAAAGTCTCCTTAA pLKO.1 1809 CDS 100% 1.080 1.512 N STXBP3 n/a
4 TRCN0000160342 CACATGAATCTCAGGTGTATA pLKO.1 489 CDS 100% 13.200 9.240 N STXBP3 n/a
5 TRCN0000313598 CCAATTGAGAATGATACATAC pLKO_005 851 CDS 100% 10.800 7.560 N Stxbp3 n/a
6 TRCN0000159248 GCTTGAAGACTACTACAAGAT pLKO.1 706 CDS 100% 4.950 3.465 N STXBP3 n/a
7 TRCN0000343183 GCTTGAAGACTACTACAAGAT pLKO_005 706 CDS 100% 4.950 3.465 N STXBP3 n/a
8 TRCN0000160595 CCTGTGAAGTTATTATTGGTT pLKO.1 1731 CDS 100% 3.000 2.100 N STXBP3 n/a
9 TRCN0000343185 CCTGTGAAGTTATTATTGGTT pLKO_005 1731 CDS 100% 3.000 2.100 N STXBP3 n/a
10 TRCN0000160627 CATCTTAACTTAGCAGAAGAT pLKO.1 1103 CDS 100% 0.495 0.347 N STXBP3 n/a
11 TRCN0000343241 CATCTTAACTTAGCAGAAGAT pLKO_005 1103 CDS 100% 0.495 0.347 N STXBP3 n/a
12 TRCN0000159454 GCCACCTATGTACATACTAAT pLKO.1 2132 3UTR 100% 13.200 7.920 N STXBP3 n/a
13 TRCN0000343186 GCCACCTATGTACATACTAAT pLKO_005 2132 3UTR 100% 13.200 7.920 N STXBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007269.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01619 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01619 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472309 GTATATTTGAAATTTCTATCAACT pLX_317 25.7% 100% 100% V5 n/a
4 ccsbBroadEn_07014 pDONR223 100% 99.8% 99.6% None 311A>G;449T>G;1116G>C n/a
5 ccsbBroad304_07014 pLX_304 0% 99.8% 99.6% V5 311A>G;449T>G;1116G>C n/a
6 TRCN0000470611 TGCAAATCACAAACATTTATAGCC pLX_317 22.1% 99.8% 99.6% V5 311A>G;449T>G;1116G>C n/a
Download CSV