Transcript: Human NM_007279.2

Homo sapiens U2 small nuclear RNA auxiliary factor 2 (U2AF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
U2AF2 (11338)
Length:
3148
CDS:
1056..2483

Additional Resources:

NCBI RefSeq record:
NM_007279.2
NBCI Gene record:
U2AF2 (11338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294641 GGTAGGAACATAGCGTGTTTA pLKO_005 2847 3UTR 100% 13.200 18.480 N U2af2 n/a
2 TRCN0000315016 GGTAGGAACATAGCGTGTTTA pLKO_005 2847 3UTR 100% 13.200 18.480 N U2AF2 n/a
3 TRCN0000001164 CGCCTTCTGTGAGTACGTGGA pLKO.1 1961 CDS 100% 0.720 1.008 N U2AF2 n/a
4 TRCN0000314964 GAAGAAGAAGGTCCGTAAATA pLKO_005 1307 CDS 100% 15.000 10.500 N U2AF2 n/a
5 TRCN0000350475 GTGTTGGCTGTGCAGATTAAC pLKO_005 1611 CDS 100% 13.200 9.240 N U2AF2 n/a
6 TRCN0000314894 CCTTTGACCAGAGGCGCTAAA pLKO_005 1245 CDS 100% 10.800 7.560 N U2AF2 n/a
7 TRCN0000109095 GCAACTGGAATGGCAGCAATT pLKO.1 2608 3UTR 100% 10.800 7.560 N U2af2 n/a
8 TRCN0000109097 GTGGAGTTCACCTCTGTGTTT pLKO.1 2355 CDS 100% 4.950 3.465 N U2af2 n/a
9 TRCN0000287196 GTGGAGTTCACCTCTGTGTTT pLKO_005 2355 CDS 100% 4.950 3.465 N U2af2 n/a
10 TRCN0000001163 TGCAGATTAACCAGGACAAGA pLKO.1 1621 CDS 100% 4.950 3.465 N U2AF2 n/a
11 TRCN0000001162 CGACGAGGAGTATGAGGAGAT pLKO.1 2228 CDS 100% 4.050 2.835 N U2AF2 n/a
12 TRCN0000314892 CGACGAGGAGTATGAGGAGAT pLKO_005 2228 CDS 100% 4.050 2.835 N U2AF2 n/a
13 TRCN0000001161 GAAGAAGAAGAAGGTCCGTAA pLKO.1 1304 CDS 100% 4.050 2.835 N U2AF2 n/a
14 TRCN0000001160 GAAGACGATGGGCAGAGGAGT pLKO.1 2559 3UTR 100% 0.880 0.616 N U2AF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479556 ACGAAAGCCTCATCTGGTGCATAC pLX_317 20.7% 99.1% 99.1% V5 1032_1043del n/a
2 ccsbBroadEn_07799 pDONR223 100% 99% 99.1% None 1032_1043del;1419C>T n/a
3 ccsbBroad304_07799 pLX_304 0% 99% 99.1% V5 1032_1043del;1419C>T n/a
Download CSV