Transcript: Human NM_007285.7

Homo sapiens GABA type A receptor associated protein like 2 (GABARAPL2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
GABARAPL2 (11345)
Length:
974
CDS:
109..462

Additional Resources:

NCBI RefSeq record:
NM_007285.7
NBCI Gene record:
GABARAPL2 (11345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007285.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048283 CGCGAAGATTCGAGCGAAATA pLKO.1 162 CDS 100% 13.200 18.480 N GABARAPL2 n/a
2 TRCN0000289945 CGCGAAGATTCGAGCGAAATA pLKO_005 162 CDS 100% 13.200 18.480 N GABARAPL2 n/a
3 TRCN0000048284 CCTAACTATGGGACAGCTTTA pLKO.1 372 CDS 100% 10.800 15.120 N GABARAPL2 n/a
4 TRCN0000289944 CCTAACTATGGGACAGCTTTA pLKO_005 372 CDS 100% 10.800 15.120 N GABARAPL2 n/a
5 TRCN0000048286 GACAGCTTTACGAGAAGGAAA pLKO.1 383 CDS 100% 4.950 6.930 N GABARAPL2 n/a
6 TRCN0000289947 GACAGCTTTACGAGAAGGAAA pLKO_005 383 CDS 100% 4.950 6.930 N GABARAPL2 n/a
7 TRCN0000048287 AGGCTCTCAGATTGTTGACAT pLKO.1 219 CDS 100% 4.950 3.960 N GABARAPL2 n/a
8 TRCN0000289948 AGGCTCTCAGATTGTTGACAT pLKO_005 219 CDS 100% 4.950 3.960 N GABARAPL2 n/a
9 TRCN0000048285 GCGATCTTCCTGTTTGTGGAT pLKO.1 331 CDS 100% 2.640 2.112 N GABARAPL2 n/a
10 TRCN0000289946 GCGATCTTCCTGTTTGTGGAT pLKO_005 331 CDS 100% 2.640 2.112 N GABARAPL2 n/a
11 TRCN0000353543 CCACAGTCCAGCCTAACTATG pLKO_005 361 CDS 100% 10.800 7.560 N Gabarapl2 n/a
12 TRCN0000120781 GCCTAACTATGGGACAGCTTT pLKO.1 371 CDS 100% 4.950 3.465 N Gabarapl2 n/a
13 TRCN0000336521 CTCAGTTCATGTGGATCATCA pLKO_005 281 CDS 100% 4.950 2.970 N Gabarapl2 n/a
14 TRCN0000120778 TGGAACACAGATGCGTGGAAT pLKO.1 140 CDS 100% 4.950 3.465 N Gabarapl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007285.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02682 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02682 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468289 AACCAAGTGTTCCATATACCACAC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_15742 pDONR223 0% 99.7% 100% None 153T>C n/a
5 ccsbBroad304_15742 pLX_304 0% 99.7% 100% V5 153T>C n/a
6 TRCN0000474868 TGCGTGAGGTTCCTACTACGACGC pLX_317 100% 99.7% 100% V5 153T>C n/a
Download CSV