Transcript: Human NM_007358.4

Homo sapiens metal response element binding transcription factor 2 (MTF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MTF2 (22823)
Length:
4075
CDS:
245..2026

Additional Resources:

NCBI RefSeq record:
NM_007358.4
NBCI Gene record:
MTF2 (22823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379989 GAACTCCATTACCAGTTATTT pLKO_005 1891 CDS 100% 15.000 21.000 N MTF2 n/a
2 TRCN0000245035 GCATGTTCTGGAGGCATTAAA pLKO_005 1198 CDS 100% 15.000 12.000 N Mtf2 n/a
3 TRCN0000303983 GCATGTTCTGGAGGCATTAAA pLKO_005 1198 CDS 100% 15.000 12.000 N MTF2 n/a
4 TRCN0000107682 GCACTTAAGAAAGGACCAAAT pLKO.1 737 CDS 100% 10.800 8.640 N MTF2 n/a
5 TRCN0000300312 GCACTTAAGAAAGGACCAAAT pLKO_005 737 CDS 100% 10.800 8.640 N MTF2 n/a
6 TRCN0000303893 CATGTAGATAGCACAAGTATT pLKO_005 2380 3UTR 100% 13.200 9.240 N MTF2 n/a
7 TRCN0000303973 CCATTACAGTGGGTAGATATA pLKO_005 1031 CDS 100% 13.200 9.240 N MTF2 n/a
8 TRCN0000107680 CCTGTCAATGTTATGGATATT pLKO.1 2177 3UTR 100% 13.200 9.240 N MTF2 n/a
9 TRCN0000086133 GCCTGCTGCAATACCACATTT pLKO.1 1711 CDS 100% 13.200 9.240 N Mtf2 n/a
10 TRCN0000257182 GGAGTATATATCCCATAATTC pLKO_005 2689 3UTR 100% 13.200 9.240 N Mtf2 n/a
11 TRCN0000245032 TCCCAATGAAATGGTTATATG pLKO_005 589 CDS 100% 13.200 9.240 N Mtf2 n/a
12 TRCN0000303915 TCCCAATGAAATGGTTATATG pLKO_005 589 CDS 100% 13.200 9.240 N MTF2 n/a
13 TRCN0000107684 CCAAACCTATATCTGATTCAA pLKO.1 1383 CDS 100% 5.625 3.938 N MTF2 n/a
14 TRCN0000107681 CGTCTAGCATTTCCAGGCATT pLKO.1 1644 CDS 100% 4.050 2.835 N MTF2 n/a
15 TRCN0000086137 CCACCAAATGTGGCTTTCAAA pLKO.1 1304 CDS 100% 5.625 3.375 N Mtf2 n/a
16 TRCN0000107683 GTGTGATTGATTCAGATGAAA pLKO.1 666 CDS 100% 5.625 3.375 N MTF2 n/a
17 TRCN0000245033 GGCCCTGGAGACTGGTATTTA pLKO_005 866 CDS 100% 15.000 12.000 N Mtf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02688 pDONR223 100% 90.3% 90.3% None 990_1160del n/a
2 ccsbBroad304_02688 pLX_304 0% 90.3% 90.3% V5 990_1160del n/a
Download CSV