Transcript: Mouse NM_007494.3

Mus musculus argininosuccinate synthetase 1 (Ass1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ass1 (11898)
Length:
1631
CDS:
140..1378

Additional Resources:

NCBI RefSeq record:
NM_007494.3
NBCI Gene record:
Ass1 (11898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439187 CTTTGAGCTCACCTGCTATTC pLKO_005 520 CDS 100% 10.800 6.480 N Ass1 n/a
2 TRCN0000075718 CTCCCAGGCTTCAGCATTAAT pLKO.1 1418 3UTR 100% 15.000 7.500 Y Ass1 n/a
3 TRCN0000418078 CATCCTTTACCACGCTCATTT pLKO_005 1003 CDS 100% 13.200 6.600 Y Ass1 n/a
4 TRCN0000437923 GAGCAAGGTCACTGCCAAATA pLKO_005 1357 CDS 100% 13.200 6.600 Y Ass1 n/a
5 TRCN0000430289 ATTTGTAATTGTAGCTTGTTC pLKO_005 1450 3UTR 100% 4.950 2.475 Y Ass1 n/a
6 TRCN0000075719 GTCTCCACTTTCACTCTACAA pLKO.1 1231 CDS 100% 4.950 2.475 Y Ass1 n/a
7 TRCN0000075720 GTGAATTTGTTCGCCACTGTA pLKO.1 1131 CDS 100% 4.950 2.475 Y Ass1 n/a
8 TRCN0000075722 TGGCTGAAGGAACAAGGCTAT pLKO.1 206 CDS 100% 4.050 2.025 Y Ass1 n/a
9 TRCN0000075721 CTGATGGAGTATGCAAAGCAA pLKO.1 617 CDS 100% 3.000 1.500 Y Ass1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05861 pDONR223 100% 89.1% 96.8% None (many diffs) n/a
2 ccsbBroad304_05861 pLX_304 0% 89.1% 96.8% V5 (many diffs) n/a
3 TRCN0000465353 ACTAATAACATTGGTCCGTTAACG pLX_317 19.2% 89.1% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_00116 pDONR223 100% 89% 96.8% None (many diffs) n/a
5 ccsbBroad304_00116 pLX_304 0% 89% 96.8% V5 (many diffs) n/a
6 TRCN0000467990 CCTCTCAAATCGAGATCTGATGTC pLX_317 27.8% 89% 96.8% V5 (many diffs) n/a
Download CSV