Transcript: Mouse NM_007560.4

Mus musculus bone morphogenetic protein receptor, type 1B (Bmpr1b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Bmpr1b (12167)
Length:
5376
CDS:
362..1870

Additional Resources:

NCBI RefSeq record:
NM_007560.4
NBCI Gene record:
Bmpr1b (12167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007560.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361072 GGTTGGCACCAAGCGCTATAT pLKO_005 1474 CDS 100% 13.200 18.480 N Bmpr1b n/a
2 TRCN0000022495 CGGAAGACTCAGTCAACAATA pLKO.1 477 CDS 100% 13.200 10.560 N Bmpr1b n/a
3 TRCN0000368762 TTCCGAGAGACTGAGATATAT pLKO_005 1085 CDS 100% 15.000 10.500 N Bmpr1b n/a
4 TRCN0000022494 CCCAAGATCCTACGTTGTAAA pLKO.1 440 CDS 100% 13.200 9.240 N Bmpr1b n/a
5 TRCN0000361009 CCTCATCAAAGAAGATCAATT pLKO_005 620 CDS 100% 13.200 9.240 N Bmpr1b n/a
6 TRCN0000194864 CTCATCAAAGAAGATCAATTG pLKO.1 621 CDS 100% 10.800 7.560 N BMPR1B n/a
7 TRCN0000022497 GAGCTTGAATAGAAACCATTT pLKO.1 1516 CDS 100% 10.800 7.560 N Bmpr1b n/a
8 TRCN0000022496 CTGGAGGTATAGTGGAAGAAT pLKO.1 1608 CDS 100% 5.625 3.938 N Bmpr1b n/a
9 TRCN0000022498 GCAAAGTCCATGCTGAAGCTA pLKO.1 1253 CDS 100% 3.000 2.100 N Bmpr1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007560.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00168 pDONR223 100% 89.2% 98.2% None (many diffs) n/a
2 ccsbBroad304_00168 pLX_304 44.8% 89.2% 98.2% V5 (many diffs) n/a
3 TRCN0000469201 GGACTTGCCCGCCAAGATATAGTT pLX_317 34% 89.2% 98.2% V5 (many diffs) n/a
4 ccsbBroadEn_14550 pDONR223 0% 89.2% 98.2% None (many diffs) n/a
5 ccsbBroad304_14550 pLX_304 0% 89.2% 98.2% V5 (many diffs) n/a
6 TRCN0000481329 CTATGCAATTCTCGGTCGTTAGTC pLX_317 27.1% 89.2% 98.2% V5 (many diffs) n/a
7 TRCN0000488008 CAGCAATTTACAGCCACCATTAAC pLX_317 19.8% 89.2% 98.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV