Transcript: Mouse NM_007739.2

Mus musculus collagen, type VIII, alpha 1 (Col8a1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Col8a1 (12837)
Length:
5110
CDS:
221..2455

Additional Resources:

NCBI RefSeq record:
NM_007739.2
NBCI Gene record:
Col8a1 (12837)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091578 CGGTGCCTACTATGGAATCAA pLKO.1 301 CDS 100% 5.625 7.875 N Col8a1 n/a
2 TRCN0000288328 CGGTGCCTACTATGGAATCAA pLKO_005 301 CDS 100% 5.625 7.875 N Col8a1 n/a
3 TRCN0000295629 ATTAGCTGTTCCATGTTATAT pLKO_005 2705 3UTR 100% 15.000 12.000 N Col8a1 n/a
4 TRCN0000091581 GCCAGATATGGGACTAGGAAT pLKO.1 1975 CDS 100% 4.950 3.465 N Col8a1 n/a
5 TRCN0000288329 GCCAGATATGGGACTAGGAAT pLKO_005 1975 CDS 100% 4.950 3.465 N Col8a1 n/a
6 TRCN0000091580 GCTGGGAATACTGTTCATCAT pLKO.1 250 CDS 100% 4.950 3.465 N Col8a1 n/a
7 TRCN0000288396 GCTGGGAATACTGTTCATCAT pLKO_005 250 CDS 100% 4.950 3.465 N Col8a1 n/a
8 TRCN0000091579 CCTCACATGCAGTATGGCAAA pLKO.1 443 CDS 100% 4.050 2.835 N Col8a1 n/a
9 TRCN0000288394 CCTCACATGCAGTATGGCAAA pLKO_005 443 CDS 100% 4.050 2.835 N Col8a1 n/a
10 TRCN0000091582 GCCTATGAGATGCCTGCGTTT pLKO.1 2054 CDS 100% 4.050 2.835 N Col8a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00342 pDONR223 100% 87.9% 93.2% None (many diffs) n/a
2 ccsbBroad304_00342 pLX_304 0% 87.9% 93.2% V5 (many diffs) n/a
3 TRCN0000470876 GAAAACCACCGTTAAGGACGTCAC pLX_317 18% 87.9% 93.2% V5 (many diffs) n/a
Download CSV