Transcript: Mouse NM_007760.3

Mus musculus carnitine acetyltransferase (Crat), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Crat (12908)
Length:
4393
CDS:
411..2291

Additional Resources:

NCBI RefSeq record:
NM_007760.3
NBCI Gene record:
Crat (12908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429609 ACTCGCTGGCCTTTGTCAAAG pLKO_005 1831 CDS 100% 10.800 15.120 N Crat n/a
2 TRCN0000427462 GCGGTGGGAGGATTATCTATC pLKO_005 2682 3UTR 100% 10.800 15.120 N Crat n/a
3 TRCN0000430728 TAGCTAAGGGTTAAGTCTTTG pLKO_005 2726 3UTR 100% 10.800 15.120 N Crat n/a
4 TRCN0000110611 CGAGGGTGTATTGGATTTCAA pLKO.1 839 CDS 100% 5.625 7.875 N Crat n/a
5 TRCN0000110612 GCTGGCATACTACAGGATCTA pLKO.1 1724 CDS 100% 4.950 6.930 N Crat n/a
6 TRCN0000110614 CGTGGTGCATAACTACCAGTT pLKO.1 1022 CDS 100% 4.050 5.670 N Crat n/a
7 TRCN0000110613 CGCCATTGCTATGCACTTCAA pLKO.1 2039 CDS 100% 4.950 3.960 N Crat n/a
8 TRCN0000035497 CAAGACAGACTGTGTCATGTT pLKO.1 2084 CDS 100% 4.950 3.465 N CRAT n/a
9 TRCN0000110610 CCAATGTATCATCCACTCCAT pLKO.1 2518 3UTR 100% 2.640 1.848 N Crat n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10748 pDONR223 100% 75.7% 79.8% None (many diffs) n/a
2 ccsbBroad304_10748 pLX_304 0% 75.7% 79.8% V5 (many diffs) n/a
3 TRCN0000466858 TACTGGATCAGTCGGGGGAAGCAG pLX_317 16.1% 75.7% 79.8% V5 (many diffs) n/a
Download CSV