Transcript: Mouse NM_007971.2

Mus musculus enhancer of zeste 2 polycomb repressive complex 2 subunit (Ezh2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ezh2 (14056)
Length:
2665
CDS:
145..2385

Additional Resources:

NCBI RefSeq record:
NM_007971.2
NBCI Gene record:
Ezh2 (14056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304506 GCACAAGTCATCCCGTTAAAG pLKO_005 421 CDS 100% 13.200 18.480 N Ezh2 n/a
2 TRCN0000039039 GCGTATAAAGACACCACCTAA pLKO.1 1167 CDS 100% 4.950 6.930 N Ezh2 n/a
3 TRCN0000039041 GCTAGGCTAATTGGGACCAAA pLKO.1 1507 CDS 100% 4.950 6.930 N Ezh2 n/a
4 TRCN0000010475 GAAACAGCTGCCTTAGCTTCA pLKO.1 2413 3UTR 100% 4.050 5.670 N EZH2 n/a
5 TRCN0000293738 GAAACAGCTGCCTTAGCTTCA pLKO_005 2413 3UTR 100% 4.050 5.670 N EZH2 n/a
6 TRCN0000304505 ACTTGCCCACCTCGGAAATTT pLKO_005 778 CDS 100% 15.000 12.000 N Ezh2 n/a
7 TRCN0000304466 AGTCGCCTCGGTGCCTATAAT pLKO_005 453 CDS 100% 15.000 10.500 N Ezh2 n/a
8 TRCN0000304465 TTGAGTACTGTGGGCAATTTA pLKO_005 2440 3UTR 100% 15.000 10.500 N Ezh2 n/a
9 TRCN0000039040 CGGCTCCTCTAACCATGTTTA pLKO.1 1677 CDS 100% 13.200 9.240 N Ezh2 n/a
10 TRCN0000301834 CGGCTCCTCTAACCATGTTTA pLKO_005 1677 CDS 100% 13.200 9.240 N Ezh2 n/a
11 TRCN0000039043 GCTGACCATTGGGACAGTAAA pLKO.1 1915 CDS 100% 13.200 9.240 N Ezh2 n/a
12 TRCN0000039042 CCGCAGAAGAACTGAAAGAAA pLKO.1 851 CDS 100% 5.625 3.938 N Ezh2 n/a
13 TRCN0000040073 TATTGCCTTCTCACCAGCTGC pLKO.1 2543 3UTR 100% 2.160 1.512 N EZH2 n/a
14 TRCN0000286227 TATTGCCTTCTCACCAGCTGC pLKO_005 2543 3UTR 100% 2.160 1.512 N EZH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007971.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00526 pDONR223 100% 91.9% 97.6% None (many diffs) n/a
2 ccsbBroad304_00526 pLX_304 0% 91.9% 97.6% V5 (many diffs) n/a
3 TRCN0000467064 TCGGACAAAATCTCATTTTCATAA pLX_317 17.6% 91.9% 97.6% V5 (many diffs) n/a
Download CSV