Transcript: Mouse NM_007982.2

Mus musculus PTK2 protein tyrosine kinase 2 (Ptk2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ptk2 (14083)
Length:
4414
CDS:
313..3471

Additional Resources:

NCBI RefSeq record:
NM_007982.2
NBCI Gene record:
Ptk2 (14083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023488 CCTGGCATCTTTGATATTATA pLKO.1 1869 CDS 100% 15.000 21.000 N Ptk2 n/a
2 TRCN0000321963 CCTGGCATCTTTGATATTATA pLKO_005 1869 CDS 100% 15.000 21.000 N Ptk2 n/a
3 TRCN0000023484 CGGTCCAATGACAAGGTATAT pLKO.1 3067 CDS 100% 13.200 18.480 N Ptk2 n/a
4 TRCN0000321964 CGGTCCAATGACAAGGTATAT pLKO_005 3067 CDS 100% 13.200 18.480 N Ptk2 n/a
5 TRCN0000196310 GATGTTGGTTTAAAGCGATTT pLKO.1 910 CDS 100% 10.800 15.120 N PTK2 n/a
6 TRCN0000344535 GATGTTGGTTTAAAGCGATTT pLKO_005 910 CDS 100% 10.800 15.120 N PTK2 n/a
7 TRCN0000023485 GCCTTAACAATGCGTCAGTTT pLKO.1 1726 CDS 100% 4.950 6.930 N Ptk2 n/a
8 TRCN0000121130 GCCTTAACAATGCGTCAGTTT pLKO.1 1726 CDS 100% 4.950 6.930 N PTK2 n/a
9 TRCN0000350696 GCCTTAACAATGCGTCAGTTT pLKO_005 1726 CDS 100% 4.950 6.930 N Ptk2 n/a
10 TRCN0000023487 CGAGTATTAAAGGTCTTTCAT pLKO.1 415 CDS 100% 5.625 4.500 N Ptk2 n/a
11 TRCN0000194838 CCTAAGAGTTTACTGGATTCT pLKO.1 934 CDS 100% 4.950 3.960 N PTK2 n/a
12 TRCN0000321899 TATCCAGACTGTGTTGCAATA pLKO_005 3880 3UTR 100% 10.800 7.560 N Ptk2 n/a
13 TRCN0000023486 CCAACCTTAATAGAGAAGAAA pLKO.1 1007 CDS 100% 5.625 3.938 N Ptk2 n/a
14 TRCN0000026975 GTTGCCATCAATACCAAAGTT pLKO.1 1419 CDS 100% 5.625 3.938 N Gm1872 n/a
15 TRCN0000026970 GACAGATGACTATGCAGAGAT pLKO.1 1491 CDS 100% 4.950 3.465 N Gm1872 n/a
16 TRCN0000026991 TGTGTCAGAGACAGATGACTA pLKO.1 1482 CDS 100% 4.950 3.465 N Gm1872 n/a
17 TRCN0000026961 GCAGAGATCATCGATGAGGAA pLKO.1 1504 CDS 100% 2.640 1.848 N Gm1872 n/a
18 TRCN0000027011 TGAGGAAGACACATACACCAT pLKO.1 1518 CDS 100% 2.640 1.584 N Gm1872 n/a
19 TRCN0000121128 CCAGGGATTATGAGATTCAAA pLKO.1 1547 CDS 100% 5.625 3.938 N PTK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14818 pDONR223 0% 90.7% 97.3% None (many diffs) n/a
2 ccsbBroad304_14818 pLX_304 0% 90.7% 97.3% V5 (many diffs) n/a
3 TRCN0000471115 ACCCGTCAGACGGGGAGAATATCA pLX_317 13% 90.7% 97.3% V5 (many diffs) n/a
4 TRCN0000489116 AGGTTGAACTATACACTATACCTG pLX_317 12.9% 90.7% 97.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_13934 pDONR223 100% 57% 60.5% None (many diffs) n/a
6 ccsbBroad304_13934 pLX_304 0% 57% 60.5% V5 (many diffs) n/a
7 TRCN0000465393 CCGAGCTAACCTATAGCACCACCA pLX_317 11.8% 57% 60.5% V5 (many diffs) n/a
Download CSV