Transcript: Mouse NM_008028.2

Mus musculus flotillin 2 (Flot2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Flot2 (14252)
Length:
2718
CDS:
362..1501

Additional Resources:

NCBI RefSeq record:
NM_008028.2
NBCI Gene record:
Flot2 (14252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380501 TGACTAAAGTCGATGAGATTG pLKO_005 1338 CDS 100% 10.800 15.120 N Flot2 n/a
2 TRCN0000109502 CTGACTAAAGTCGATGAGATT pLKO.1 1337 CDS 100% 4.950 6.930 N Flot2 n/a
3 TRCN0000304869 CTGACTGTAGAACAGATTTAT pLKO_005 566 CDS 100% 15.000 10.500 N Flot2 n/a
4 TRCN0000380359 ACAGGGACAGCGAGAACATTT pLKO_005 1561 3UTR 100% 13.200 9.240 N Flot2 n/a
5 TRCN0000304812 CAAGGTGACATCAGAAGTAAA pLKO_005 1381 CDS 100% 13.200 9.240 N Flot2 n/a
6 TRCN0000381690 ACCAAGATCGCTGACTCTAAG pLKO_005 842 CDS 100% 10.800 7.560 N Flot2 n/a
7 TRCN0000109500 GCCTTCAAGTTCTACATGTAT pLKO.1 1877 3UTR 100% 5.625 3.938 N Flot2 n/a
8 TRCN0000109503 GCTTCACCATCAAGGATGTTT pLKO.1 666 CDS 100% 5.625 3.938 N Flot2 n/a
9 TRCN0000316514 GCTTCACCATCAAGGATGTTT pLKO_005 666 CDS 100% 5.625 3.938 N Flot2 n/a
10 TRCN0000109504 GAAGCTGAGAAGATTCGCAAA pLKO.1 1157 CDS 100% 4.050 2.835 N Flot2 n/a
11 TRCN0000316525 GAAGCTGAGAAGATTCGCAAA pLKO_005 1157 CDS 100% 4.050 2.835 N Flot2 n/a
12 TRCN0000109501 GCTGACTCTAAGAGAGCCTTT pLKO.1 851 CDS 100% 4.050 2.835 N Flot2 n/a
13 TRCN0000304813 CTCCCATGCCCTCACATTAAT pLKO_005 1675 3UTR 100% 15.000 9.000 N Flot2 n/a
14 TRCN0000150223 GAAGAGATTGAGATTGAGGTT pLKO.1 977 CDS 100% 2.640 1.848 N FLOT2 n/a
15 TRCN0000280654 GAAGAGATTGAGATTGAGGTT pLKO_005 977 CDS 100% 2.640 1.848 N FLOT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10823 pDONR223 100% 90.4% 99.2% None (many diffs) n/a
2 ccsbBroad304_10823 pLX_304 0% 90.4% 99.2% V5 (many diffs) n/a
3 TRCN0000472011 CTGCAACTGTTAATACCTCTGATA pLX_317 12.4% 90.4% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_10824 pDONR223 100% 71.1% 76.5% None (many diffs) n/a
5 ccsbBroad304_10824 pLX_304 0% 71.1% 76.5% V5 (many diffs) n/a
6 TRCN0000468885 GTGTAATATTCACATTTTTAGTGC pLX_317 9.3% 71.1% 76.5% V5 (many diffs) n/a
Download CSV