Transcript: Mouse NM_008256.4

Mus musculus 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (Hmgcs2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hmgcs2 (15360)
Length:
3294
CDS:
54..1580

Additional Resources:

NCBI RefSeq record:
NM_008256.4
NBCI Gene record:
Hmgcs2 (15360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008256.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075832 CGACTTCTACAAACCAAACTT pLKO.1 770 CDS 100% 5.625 7.875 N Hmgcs2 n/a
2 TRCN0000075831 CCTCGATGATGTGCAGTATAT pLKO.1 926 CDS 100% 13.200 10.560 N Hmgcs2 n/a
3 TRCN0000075828 CCCTCGATCTTTCCAGAACTT pLKO.1 2804 3UTR 100% 4.950 3.960 N Hmgcs2 n/a
4 TRCN0000075829 CCCTCGATGATGTGCAGTATA pLKO.1 925 CDS 100% 13.200 9.240 N Hmgcs2 n/a
5 TRCN0000075830 CCTCTCCACAAATAATGGGAA pLKO.1 1172 CDS 100% 2.640 1.848 N Hmgcs2 n/a
6 TRCN0000045862 GAGGGCATAGATACCACCAAT pLKO.1 525 CDS 100% 4.950 3.465 N HMGCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008256.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00756 pDONR223 100% 86.3% 89.3% None (many diffs) n/a
2 ccsbBroad304_00756 pLX_304 0% 86.3% 89.3% V5 (many diffs) n/a
3 TRCN0000475671 TGGTATTTCCTAATAACTATATAT pLX_317 8.2% 86.3% 89.3% V5 (many diffs) n/a
Download CSV