Transcript: Mouse NM_008509.2

Mus musculus lipoprotein lipase (Lpl), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Lpl (16956)
Length:
4049
CDS:
199..1623

Additional Resources:

NCBI RefSeq record:
NM_008509.2
NBCI Gene record:
Lpl (16956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305382 GGGTCACCTGGTCGAAGTATT pLKO_005 841 CDS 100% 13.200 18.480 N Lpl n/a
2 TRCN0000305315 GACCAATAAGAAGGTCAATAG pLKO_005 711 CDS 100% 10.800 15.120 N Lpl n/a
3 TRCN0000124552 GCATGTTGACATTTATCCCAA pLKO.1 882 CDS 100% 2.640 3.696 N Lpl n/a
4 TRCN0000124553 CCCGAGGTTTCCACAAATAAA pLKO.1 1339 CDS 100% 15.000 12.000 N Lpl n/a
5 TRCN0000309305 CCCGAGGTTTCCACAAATAAA pLKO_005 1339 CDS 100% 15.000 12.000 N Lpl n/a
6 TRCN0000305381 ACAACCAGGCCTTCGAGATTT pLKO_005 1271 CDS 100% 13.200 9.240 N Lpl n/a
7 TRCN0000305379 TCCCTTAAGAAGGAATCATTT pLKO_005 1892 3UTR 100% 13.200 9.240 N Lpl n/a
8 TRCN0000124550 GCCCTACAAAGTGTTCCATTA pLKO.1 1206 CDS 100% 10.800 7.560 N Lpl n/a
9 TRCN0000052140 CCTAACTTTGAGTATGCAGAA pLKO.1 757 CDS 100% 4.050 2.835 N LPL n/a
10 TRCN0000124551 CCAGGATGCAACATTGGAGAA pLKO.1 919 CDS 100% 4.050 2.430 N Lpl n/a
11 TRCN0000114051 GCCTGGTTTACAGAGTGAGTT pLKO.1 2436 3UTR 100% 4.950 2.475 Y H2-T3 n/a
12 TRCN0000431580 ATCTGGGCTATGAGATCAATA pLKO_005 1133 CDS 100% 13.200 9.240 N LPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491511 TTTATAGAAGGTTTCTGTGACCTC pLX_317 23.2% 88% 92.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489885 AACTGAGATCTTACTTGTTGGCAC pLX_317 28.7% 88% 92.6% V5 (many diffs) n/a
3 ccsbBroadEn_06535 pDONR223 100% 88% 92.6% None (many diffs) n/a
4 ccsbBroad304_06535 pLX_304 0% 88% 92.6% V5 (many diffs) n/a
5 TRCN0000467095 CCCTTGATCCAGACTGAGTATTTA pLX_317 30.1% 88% 92.6% V5 (many diffs) n/a
Download CSV