Transcript: Mouse NM_008659.3

Mus musculus myosin IC (Myo1c), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Myo1c (17913)
Length:
5281
CDS:
188..3274

Additional Resources:

NCBI RefSeq record:
NM_008659.3
NBCI Gene record:
Myo1c (17913)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100741 CCGCGTGAACAATATCAACAT pLKO.1 3115 CDS 100% 4.950 6.930 N Myo1c n/a
2 TRCN0000335217 CCGCGTGAACAATATCAACAT pLKO_005 3115 CDS 100% 4.950 6.930 N Myo1c n/a
3 TRCN0000348590 CCCTCTGCTGATGCCAAATAT pLKO_005 3516 3UTR 100% 15.000 10.500 N Myo1c n/a
4 TRCN0000100743 GAATTGATTATGCCAACCTAA pLKO.1 2955 CDS 100% 4.950 3.465 N Myo1c n/a
5 TRCN0000100744 GACAACAAGCAGAAGGGAGAT pLKO.1 3035 CDS 100% 4.050 2.835 N Myo1c n/a
6 TRCN0000335137 GACAACAAGCAGAAGGGAGAT pLKO_005 3035 CDS 100% 4.050 2.835 N Myo1c n/a
7 TRCN0000100740 CGACCCAATTTAAGAATGGTA pLKO.1 4308 3UTR 100% 3.000 2.100 N Myo1c n/a
8 TRCN0000100742 GCTTTGCCTATCGTCGCAAAT pLKO.1 2064 CDS 100% 1.080 0.756 N Myo1c n/a
9 TRCN0000335215 GCTTTGCCTATCGTCGCAAAT pLKO_005 2064 CDS 100% 1.080 0.756 N Myo1c n/a
10 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 5135 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06611 pDONR223 100% 88.7% 96.8% None (many diffs) n/a
2 ccsbBroad304_06611 pLX_304 0% 88.7% 96.8% V5 (many diffs) n/a
3 TRCN0000465253 CTCCACCCCGAGGCCGGGTTTTAG pLX_317 9.2% 88.7% 96.8% V5 (many diffs) n/a
Download CSV