Transcript: Mouse NM_008665.4

Mus musculus myelin transcription factor 1 (Myt1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Myt1 (17932)
Length:
5529
CDS:
415..3798

Additional Resources:

NCBI RefSeq record:
NM_008665.4
NBCI Gene record:
Myt1 (17932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008665.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081610 CCCAGAGCTATCTAGTCCTAA pLKO.1 1410 CDS 100% 4.950 6.930 N Myt1 n/a
2 TRCN0000081609 CGAGACTTAAATGAGTCCAAT pLKO.1 3454 CDS 100% 4.950 6.930 N Myt1 n/a
3 TRCN0000081611 CGCAATACTCACAGAAGTTTA pLKO.1 1921 CDS 100% 13.200 9.240 N Myt1 n/a
4 TRCN0000081612 GAGACTTAAATGAGTCCAATT pLKO.1 3455 CDS 100% 10.800 7.560 N Myt1 n/a
5 TRCN0000081608 GCCACAAAGAATCTTGATATA pLKO.1 5023 3UTR 100% 13.200 7.920 N Myt1 n/a
6 TRCN0000434193 AGGAGGAGGAAGAAGATGAAG pLKO_005 1202 CDS 100% 4.950 2.475 Y Myt1 n/a
7 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1286 CDS 100% 4.050 2.025 Y Myt1 n/a
8 TRCN0000413410 AGGAGGAAGATGAAGAGGAAG pLKO_005 1298 CDS 100% 4.050 2.025 Y Myt1 n/a
9 TRCN0000415029 AGGAGAAGAAGAAGAGGAGGA pLKO_005 1260 CDS 100% 2.160 1.080 Y Myt1 n/a
10 TRCN0000419222 GAAGAAGAAGAGGATGAGGAG pLKO_005 1219 CDS 100% 2.160 1.080 Y Myt1 n/a
11 TRCN0000418963 ACCTTTGACTACGCAAGTTTC pLKO_005 2170 CDS 100% 10.800 15.120 N MYT1 n/a
12 TRCN0000092929 GAGGAAGATGAAGAGGAAGAA pLKO.1 1300 CDS 100% 4.950 2.475 Y Gm13237 n/a
13 TRCN0000250444 CCATGGAGAAGAACCTGAATC pLKO_005 3521 CDS 100% 10.800 5.400 Y Ftl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008665.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10986 pDONR223 100% 46.2% 47.7% None (many diffs) n/a
2 ccsbBroad304_10986 pLX_304 0% 46.2% 47.7% V5 (many diffs) n/a
3 TRCN0000478582 TGTATTTATACTCCTTCTGAGAAT pLX_317 22.5% 46.2% 47.7% V5 (many diffs) n/a
Download CSV