Transcript: Mouse NM_008682.2

Mus musculus neural precursor cell expressed, developmentally down-regulated gene 1 (Nedd1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Nedd1 (17997)
Length:
3542
CDS:
105..2087

Additional Resources:

NCBI RefSeq record:
NM_008682.2
NBCI Gene record:
Nedd1 (17997)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248320 GAAGATTCAAGGGCTATATAT pLKO_005 2659 3UTR 100% 15.000 10.500 N Nedd1 n/a
2 TRCN0000248319 TTGGGCAGCGTTTCGGATAAT pLKO_005 636 CDS 100% 13.200 9.240 N Nedd1 n/a
3 TRCN0000248317 TCGGTCTCTTAAGGATCATAA pLKO_005 440 CDS 100% 13.200 7.920 N Nedd1 n/a
4 TRCN0000248316 AGCAGACATGTGTCGATTTAA pLKO_005 340 CDS 100% 15.000 7.500 Y Nedd1 n/a
5 TRCN0000248318 TGGCAAGTGGAGGCCTAAATA pLKO_005 379 CDS 100% 15.000 7.500 Y Nedd1 n/a
6 TRCN0000178134 GTTCCTGACATTGGTGGATAA pLKO.1 164 CDS 100% 10.800 5.400 Y Nedd1 n/a
7 TRCN0000177689 CCGCTTCATTCAGAACATGAT pLKO.1 1871 CDS 100% 4.950 2.475 Y Nedd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04751 pDONR223 100% 85.2% 85.4% None (many diffs) n/a
2 ccsbBroad304_04751 pLX_304 0% 85.2% 85.4% V5 (many diffs) n/a
3 TRCN0000479792 CCTGGGCTACGAACCGCCCCACCT pLX_317 20.8% 85.2% 85.4% V5 (many diffs) n/a
Download CSV