Transcript: Mouse NM_008695.2

Mus musculus nidogen 2 (Nid2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nid2 (18074)
Length:
4913
CDS:
82..4293

Additional Resources:

NCBI RefSeq record:
NM_008695.2
NBCI Gene record:
Nid2 (18074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114785 CGTCAGCTATGCAGATCACTT pLKO.1 4128 CDS 100% 4.950 6.930 N Nid2 n/a
2 TRCN0000336526 CGTCAGCTATGCAGATCACTT pLKO_005 4128 CDS 100% 4.950 6.930 N Nid2 n/a
3 TRCN0000114783 CGAATTTCACAGCCCACATTA pLKO.1 2120 CDS 100% 13.200 9.240 N Nid2 n/a
4 TRCN0000336524 CGAATTTCACAGCCCACATTA pLKO_005 2120 CDS 100% 13.200 9.240 N Nid2 n/a
5 TRCN0000114784 CCCGAAGTTTCTCTCTCACTT pLKO.1 2195 CDS 100% 4.950 3.465 N Nid2 n/a
6 TRCN0000336462 CCCGAAGTTTCTCTCTCACTT pLKO_005 2195 CDS 100% 4.950 3.465 N Nid2 n/a
7 TRCN0000114781 CCTCAATCTTTACTACTGTAT pLKO.1 4458 3UTR 100% 4.950 3.465 N Nid2 n/a
8 TRCN0000336463 CCTCAATCTTTACTACTGTAT pLKO_005 4458 3UTR 100% 4.950 3.465 N Nid2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11625 pDONR223 100% 58.4% 59% None (many diffs) n/a
2 ccsbBroad304_11625 pLX_304 0% 58.4% 59% V5 (many diffs) n/a
3 TRCN0000492085 ATCACAATGGGTACAGTACTCTGA pLX_317 15.2% 58.4% 59% V5 (many diffs) n/a
Download CSV