Transcript: Mouse NM_008921.2

Mus musculus DNA primase, p49 subunit (Prim1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Prim1 (19075)
Length:
1533
CDS:
35..1288

Additional Resources:

NCBI RefSeq record:
NM_008921.2
NBCI Gene record:
Prim1 (19075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119955 CCGGAGCTACTCAAGCTTTAT pLKO.1 62 CDS 100% 13.200 18.480 N Prim1 n/a
2 TRCN0000275195 GATTGATATAGGCGCAGTATA pLKO_005 265 CDS 100% 13.200 18.480 N PRIM1 n/a
3 TRCN0000119954 GCCGGGAATTGGATATGGTTT pLKO.1 1092 CDS 100% 4.950 6.930 N Prim1 n/a
4 TRCN0000119956 TGGATCAATTTGATCCGTTTA pLKO.1 1047 CDS 100% 1.080 1.512 N Prim1 n/a
5 TRCN0000119953 GCACCGTATGTGAAAGTATTT pLKO.1 1190 CDS 100% 13.200 9.240 N Prim1 n/a
6 TRCN0000119952 GCCTCAATCCTTGAAGCAGAA pLKO.1 1374 3UTR 100% 4.050 2.835 N Prim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01275 pDONR223 100% 87.3% 90.4% None (many diffs) n/a
2 ccsbBroad304_01275 pLX_304 0% 87.3% 90.4% V5 (many diffs) n/a
3 TRCN0000467988 GTTTTGTGATCCATTCCTCAATTT pLX_317 25.7% 87.3% 90.4% V5 (many diffs) n/a
Download CSV