Transcript: Mouse NM_008926.4

Mus musculus protein kinase, cGMP-dependent, type II (Prkg2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Prkg2 (19092)
Length:
4696
CDS:
171..2459

Additional Resources:

NCBI RefSeq record:
NM_008926.4
NBCI Gene record:
Prkg2 (19092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008926.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361374 ACGTCAGATCAGCCAATATAA pLKO_005 1261 CDS 100% 15.000 21.000 N Prkg2 n/a
2 TRCN0000361437 GAACGGGATCAACGACATTAA pLKO_005 2267 CDS 100% 13.200 18.480 N Prkg2 n/a
3 TRCN0000361375 ATGTCGCATGCCTCGTGATAG pLKO_005 1297 CDS 100% 10.800 15.120 N Prkg2 n/a
4 TRCN0000022716 CCAATATAATTGCGGAAGAAA pLKO.1 1273 CDS 100% 5.625 7.875 N Prkg2 n/a
5 TRCN0000022717 CGTGAAGTTGTATCGTACTTT pLKO.1 1709 CDS 100% 5.625 7.875 N Prkg2 n/a
6 TRCN0000022714 GCCTCGTGATAGATCGAGAAA pLKO.1 1306 CDS 100% 4.950 6.930 N Prkg2 n/a
7 TRCN0000001511 GACCAAATGATGACCTACAAT pLKO.1 2130 CDS 100% 5.625 4.500 N PRKG2 n/a
8 TRCN0000197105 GCTTGGAAGTGGAATACTATG pLKO.1 1072 CDS 100% 10.800 7.560 N PRKG2 n/a
9 TRCN0000022715 CCCGAGGTCATTCTTAACAAA pLKO.1 2025 CDS 100% 5.625 3.938 N Prkg2 n/a
10 TRCN0000022718 CCGAACCTATGACCTCAACAA pLKO.1 563 CDS 100% 4.950 3.465 N Prkg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008926.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14798 pDONR223 70.9% 88.2% 29.5% None (many diffs) n/a
2 ccsbBroad304_14798 pLX_304 0% 88.2% 29.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474788 GTGGCTATCTTTATGGTCCATATC pLX_317 19.2% 88.2% 29.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV