Transcript: Mouse NM_008942.2

Mus musculus aminopeptidase puromycin sensitive (Npepps), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Npepps (19155)
Length:
4161
CDS:
119..2881

Additional Resources:

NCBI RefSeq record:
NM_008942.2
NBCI Gene record:
Npepps (19155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031107 GCCATGCTCGAAAGTTTATTA pLKO.1 1907 CDS 100% 15.000 21.000 N Npepps n/a
2 TRCN0000313596 TGATGAATTGTGCTGATATTG pLKO_005 402 CDS 100% 13.200 18.480 N Npepps n/a
3 TRCN0000031106 GCCTGCTATCAAAGCAACTTT pLKO.1 700 CDS 100% 5.625 7.875 N Npepps n/a
4 TRCN0000317190 GCCTGCTATCAAAGCAACTTT pLKO_005 700 CDS 100% 5.625 7.875 N Npepps n/a
5 TRCN0000031105 GCCTTGTTACTTATAGGGAAA pLKO.1 1086 CDS 100% 4.050 5.670 N Npepps n/a
6 TRCN0000313597 CTCCTGTTAGTGACGGATATT pLKO_005 3187 3UTR 100% 13.200 10.560 N Npepps n/a
7 TRCN0000296878 TTGTGAATGAGCCCAATTATA pLKO_005 2049 CDS 100% 15.000 10.500 N NPEPPS n/a
8 TRCN0000313586 TTGTGAATGAGCCCAATTATA pLKO_005 2049 CDS 100% 15.000 10.500 N Npepps n/a
9 TRCN0000313550 AGAAGCCCGTCGTCGGTTTAA pLKO_005 2290 CDS 100% 13.200 9.240 N Npepps n/a
10 TRCN0000031108 CGAATGCTACATGACTACATT pLKO.1 1457 CDS 100% 5.625 3.938 N Npepps n/a
11 TRCN0000031104 CCTGGGCCTCACTGCCTCTCT pLKO.1 2895 3UTR 100% 0.000 0.000 N Npepps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11380 pDONR223 100% 88.6% 93.1% None (many diffs) n/a
2 ccsbBroad304_11380 pLX_304 0% 88.6% 93.1% V5 (many diffs) n/a
3 TRCN0000476461 ATGTGTCTCAGCCTTCGAGTTGCC pLX_317 14.1% 88.6% 93.1% V5 (many diffs) n/a
Download CSV