Transcript: Mouse NM_008965.2

Mus musculus prostaglandin E receptor 4 (subtype EP4) (Ptger4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ptger4 (19219)
Length:
3264
CDS:
490..2031

Additional Resources:

NCBI RefSeq record:
NM_008965.2
NBCI Gene record:
Ptger4 (19219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008965.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329394 GCCAATATAACCAGCTAATAT pLKO_005 2508 3UTR 100% 15.000 21.000 N Ptger4 n/a
2 TRCN0000027938 CGCTGAGAACTTTGCGAATTT pLKO.1 1853 CDS 100% 13.200 18.480 N Ptger4 n/a
3 TRCN0000027895 CCAGTGAAACTCTGAAATTAT pLKO.1 1994 CDS 100% 15.000 10.500 N Ptger4 n/a
4 TRCN0000329392 GTGTTCATTAACCAGTTATAT pLKO_005 1447 CDS 100% 15.000 10.500 N Ptger4 n/a
5 TRCN0000329322 CCTGGTGGCCATCGTAGTATT pLKO_005 669 CDS 100% 13.200 9.240 N Ptger4 n/a
6 TRCN0000329323 GCTGAGAACTTTGCGAATTTC pLKO_005 1854 CDS 100% 13.200 9.240 N Ptger4 n/a
7 TRCN0000329321 TTCGCCATCTATGCATCTAAC pLKO_005 985 CDS 100% 10.800 7.560 N Ptger4 n/a
8 TRCN0000027936 CCCTGGATTTACATCCTTCTT pLKO.1 1549 CDS 100% 4.950 3.465 N Ptger4 n/a
9 TRCN0000027915 CGAGTGTTCATTAACCAGTTA pLKO.1 1444 CDS 100% 4.950 3.465 N Ptger4 n/a
10 TRCN0000027857 GCTGTGTGTTACTAACCACCA pLKO.1 539 CDS 100% 2.160 1.512 N Ptger4 n/a
11 TRCN0000218566 AGATGGTCATCTTACTCATTG pLKO_005 1379 CDS 100% 10.800 15.120 N PTGER4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008965.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01332 pDONR223 100% 81.6% 83.5% None (many diffs) n/a
2 ccsbBroad304_01332 pLX_304 0% 81.6% 83.5% V5 (many diffs) n/a
3 TRCN0000481040 TAAACACTATCCCGTGTATTGCCG pLX_317 25.9% 81.6% 83.5% V5 (many diffs) n/a
4 TRCN0000487702 CAACAGCCAAGACTCGGACTTCTT pLX_317 16.6% 81.6% 83.5% V5 (many diffs) n/a
5 TRCN0000488601 GCGCAGGACTACTCTTTGGCGTTC pLX_317 19.7% 81.6% 83.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000492177 TTAGAGTCATGAATGAATGACAAA pLX_317 25.9% 81.4% 83.5% V5 (many diffs) n/a
Download CSV