Transcript: Mouse NM_009006.3

Mus musculus mitogen-activated protein kinase kinase kinase kinase 2 (Map4k2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Map4k2 (26412)
Length:
4679
CDS:
91..2556

Additional Resources:

NCBI RefSeq record:
NM_009006.3
NBCI Gene record:
Map4k2 (26412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009006.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025175 TGACCGATTGTGGATCTGTAT pLKO.1 339 CDS 100% 4.950 6.930 N Map4k2 n/a
2 TRCN0000025178 GTTCTTTCATTGGCACTCCAT pLKO.1 596 CDS 100% 2.640 3.696 N Map4k2 n/a
3 TRCN0000025177 CTAACCTTTGACTTCACTATT pLKO.1 2311 CDS 100% 13.200 9.240 N Map4k2 n/a
4 TRCN0000350721 CTAACCTTTGACTTCACTATT pLKO_005 2311 CDS 100% 13.200 9.240 N Map4k2 n/a
5 TRCN0000350684 ACGGCAGATTGCCTATGTTTG pLKO_005 420 CDS 100% 10.800 7.560 N Map4k2 n/a
6 TRCN0000025176 CTGGCTCTACTGTGTGAACAA pLKO.1 1686 CDS 100% 4.950 3.465 N Map4k2 n/a
7 TRCN0000322210 CTGGCTCTACTGTGTGAACAA pLKO_005 1686 CDS 100% 4.950 3.465 N Map4k2 n/a
8 TRCN0000025174 GCCTTGATGCTCATGTCGAAA pLKO.1 754 CDS 100% 4.950 3.465 N Map4k2 n/a
9 TRCN0000322209 GCCTTGATGCTCATGTCGAAA pLKO_005 754 CDS 100% 4.950 3.465 N Map4k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009006.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489563 ACTGCTTTGCCCAAGCATGATCTT pLX_317 15.4% 87.7% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487902 TCATCCTTGACTCCCCAGTACCCG pLX_317 8.7% 87.7% 93.5% V5 (many diffs) n/a
3 ccsbBroadEn_11085 pDONR223 100% 87.1% 93.4% None (many diffs) n/a
4 ccsbBroad304_11085 pLX_304 0% 87.1% 93.4% V5 (many diffs) n/a
5 ccsbBroadEn_14823 pDONR223 0% 87.1% 93.4% None (many diffs) n/a
6 ccsbBroad304_14823 pLX_304 0% 87.1% 93.4% V5 (many diffs) n/a
7 TRCN0000474639 TACTGTCCCAAACGGCTAAGTACA pLX_317 15.5% 87.1% 93.4% V5 (many diffs) n/a
8 TRCN0000488749 ATAAGTAATATTGATTAAGTAGCT pLX_317 13.4% 87.1% 93.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV