Transcript: Mouse NM_009022.4

Mus musculus aldehyde dehydrogenase family 1, subfamily A2 (Aldh1a2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Aldh1a2 (19378)
Length:
2264
CDS:
59..1615

Additional Resources:

NCBI RefSeq record:
NM_009022.4
NBCI Gene record:
Aldh1a2 (19378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009022.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041936 GCAACTATGGAATCCCTAAAT pLKO.1 419 CDS 100% 13.200 18.480 N Aldh1a2 n/a
2 TRCN0000041934 CGAGATCAAGTACACCAAGAT pLKO.1 157 CDS 100% 4.950 6.930 N Aldh1a2 n/a
3 TRCN0000041933 GAATCCATCTATGAGGAATTT pLKO.1 1046 CDS 100% 13.200 9.240 N Aldh1a2 n/a
4 TRCN0000233273 TCCTGTAGATGGAGACTATTT pLKO_005 544 CDS 100% 13.200 9.240 N ALDH1A2 n/a
5 TRCN0000041935 GTCACTGATGACATGCGGATT pLKO.1 1277 CDS 100% 4.050 2.835 N Aldh1a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009022.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07315 pDONR223 100% 83.5% 89.9% None (many diffs) n/a
2 ccsbBroad304_07315 pLX_304 0% 83.5% 89.9% V5 (many diffs) n/a
3 TRCN0000481330 ACATTGTCCTTTTTTCCTCAGGTT pLX_317 31% 83.5% 89.9% V5 (many diffs) n/a
Download CSV