Transcript: Mouse NM_009080.2

Mus musculus ribosomal protein L26 (Rpl26), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rpl26 (19941)
Length:
564
CDS:
65..502

Additional Resources:

NCBI RefSeq record:
NM_009080.2
NBCI Gene record:
Rpl26 (19941)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434021 GGGCAAATACAAGGAAGAAAC pLKO_005 460 CDS 100% 10.800 5.400 Y RPL26 n/a
2 TRCN0000104292 GAACCGCAAACGGCATTTCAA pLKO.1 103 CDS 100% 5.625 2.813 Y Rpl26 n/a
3 TRCN0000104290 CCAAGTGTACAGGAAGAAGTA pLKO.1 277 CDS 100% 4.950 2.475 Y Rpl26 n/a
4 TRCN0000104294 CTCTCACATTCGGAGGAAGAT pLKO.1 130 CDS 100% 4.950 2.475 Y Rpl26 n/a
5 TRCN0000104291 GATGACGAAGTTCAGGTTGTT pLKO.1 218 CDS 100% 4.950 2.475 Y Rpl26 n/a
6 TRCN0000104293 AGGTCGTTATCACCAGGCTAA pLKO.1 372 CDS 100% 4.050 2.025 Y Rpl26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01428 pDONR223 100% 87.8% 100% None (many diffs) n/a
2 ccsbBroad304_01428 pLX_304 0% 87.8% 100% V5 (many diffs) n/a
3 TRCN0000491407 ATACTTCTGGCTACTGGTCGTCCA pLX_317 77.7% 87.8% 100% V5 (many diffs) n/a
4 ccsbBroadEn_03218 pDONR223 100% 83.6% 98.6% None (many diffs) n/a
5 ccsbBroad304_03218 pLX_304 0% 83.6% 98.6% V5 (many diffs) n/a
6 TRCN0000471468 TGCCTACAGACGGAAAGGTACGAT pLX_317 100% 83.6% 98.6% V5 (many diffs) n/a
Download CSV