Transcript: Mouse NM_009084.4

Mus musculus ribosomal protein L37a (Rpl37a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rpl37a (19981)
Length:
601
CDS:
62..340

Additional Resources:

NCBI RefSeq record:
NM_009084.4
NBCI Gene record:
Rpl37a (19981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009084.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104210 CCAAGTACACTTGCTCCTTCT pLKO.1 165 CDS 100% 4.050 2.430 N Rpl37a n/a
2 TRCN0000104213 CACTTGCTCCTTCTGTGGCAA pLKO.1 172 CDS 100% 2.640 1.584 N Rpl37a n/a
3 TRCN0000377347 TGAAATCAGCCAGCACGCCAA pLKO_005 148 CDS 100% 2.160 1.296 N RPL37A n/a
4 TRCN0000104211 CGGCAAGTACGGGACCCGCTA pLKO.1 94 CDS 100% 0.000 0.000 N Rpl37a n/a
5 TRCN0000104214 CAGTGAAGTCTGCCATCAGAA pLKO.1 294 CDS 100% 4.950 2.475 Y Rpl37a n/a
6 TRCN0000117449 GCACTGTGGTTCCTGCATGAA pLKO.1 226 CDS 100% 4.950 2.475 Y RPL37A n/a
7 TRCN0000333512 GCACTGTGGTTCCTGCATGAA pLKO_005 226 CDS 100% 4.950 2.475 Y RPL37A n/a
8 TRCN0000104212 GCCATCAGAAGACTGAAGGAA pLKO.1 305 CDS 100% 3.000 1.500 Y Rpl37a n/a
9 TRCN0000117450 CCATCAGAAGACTGAAGGAGT pLKO.1 306 CDS 100% 2.640 1.320 Y RPL37A n/a
10 TRCN0000333449 CCATCAGAAGACTGAAGGAGT pLKO_005 306 CDS 100% 2.640 1.320 Y RPL37A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009084.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01439 pDONR223 100% 90.5% 100% None (many diffs) n/a
2 ccsbBroad304_01439 pLX_304 0% 90.5% 100% V5 (many diffs) n/a
3 TRCN0000471130 CAGTTAACCCTCCGACACTTCCCT pLX_317 100% 90.5% 100% V5 (many diffs) n/a
4 ccsbBroadEn_15574 pDONR223 0% 71.7% 77.1% None (many diffs) n/a
5 ccsbBroad304_15574 pLX_304 0% 71.7% 77.1% V5 (many diffs) n/a
Download CSV