Transcript: Mouse NM_009107.3

Mus musculus retinoid X receptor gamma (Rxrg), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rxrg (20183)
Length:
2151
CDS:
391..1782

Additional Resources:

NCBI RefSeq record:
NM_009107.3
NBCI Gene record:
Rxrg (20183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222381 CTCCGTATAGAGTCATCACTT pLKO.1 593 CDS 100% 4.950 6.930 N Rxrg n/a
2 TRCN0000222382 GCTGTTTAACCCAGATGCCAA pLKO.1 1515 CDS 100% 2.640 3.696 N Rxrg n/a
3 TRCN0000438766 GTGGCCCTTCTTTGCTATTTA pLKO_005 1973 3UTR 100% 15.000 12.000 N Rxrg n/a
4 TRCN0000222384 CATCTACACCTGTCGGGATAA pLKO.1 903 CDS 100% 10.800 7.560 N Rxrg n/a
5 TRCN0000445690 GACTCTTCGAGAGAAGGTTTA pLKO_005 1563 CDS 100% 10.800 7.560 N Rxrg n/a
6 TRCN0000222383 CGGTGACATGAACGTGGAGAA pLKO.1 1149 CDS 100% 4.050 2.835 N Rxrg n/a
7 TRCN0000222385 CCAAGATGAAAGACATGCAGA pLKO.1 1457 CDS 100% 2.640 1.848 N Rxrg n/a
8 TRCN0000338870 ATGACCCTGTTACCAACATAT pLKO_005 1178 CDS 100% 13.200 6.600 Y RXRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01470 pDONR223 100% 90.2% 98.2% None (many diffs) n/a
2 ccsbBroad304_01470 pLX_304 0% 90.2% 98.2% V5 (many diffs) n/a
3 TRCN0000478997 TGAGATGGCGAACCGTTGGAATAG pLX_317 16.8% 90.2% 98.2% V5 (many diffs) n/a
Download CSV