Transcript: Mouse NM_009273.4

Mus musculus signal recognition particle 14 (Srp14), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Srp14 (20813)
Length:
790
CDS:
83..415

Additional Resources:

NCBI RefSeq record:
NM_009273.4
NBCI Gene record:
Srp14 (20813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009273.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102424 CAGATGGCCTATTCAAATCTA pLKO.1 320 CDS 100% 5.625 3.938 N Srp14 n/a
2 TRCN0000327545 CAGATGGCCTATTCAAATCTA pLKO_005 320 CDS 100% 5.625 3.938 N Srp14 n/a
3 TRCN0000102422 AGAAGTGAACAAGTTTCAGAT pLKO.1 304 CDS 100% 4.950 3.465 N Srp14 n/a
4 TRCN0000327542 AGAAGTGAACAAGTTTCAGAT pLKO_005 304 CDS 100% 4.950 3.465 N Srp14 n/a
5 TRCN0000102423 CGTGTTCATCACCCTCAAGAA pLKO.1 157 CDS 100% 4.950 3.465 N Srp14 n/a
6 TRCN0000327546 CGTGTTCATCACCCTCAAGAA pLKO_005 157 CDS 100% 4.950 3.465 N Srp14 n/a
7 TRCN0000102420 GCACCTCTGTATGTAACTGTT pLKO.1 476 3UTR 100% 4.950 3.465 N Srp14 n/a
8 TRCN0000327625 GCACCTCTGTATGTAACTGTT pLKO_005 476 3UTR 100% 4.950 3.465 N Srp14 n/a
9 TRCN0000102421 GAACAAGAGTAAGAAGAGCAA pLKO.1 382 CDS 100% 2.640 1.848 N Srp14 n/a
10 TRCN0000327624 GAACAAGAGTAAGAAGAGCAA pLKO_005 382 CDS 100% 2.640 1.848 N Srp14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009273.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01593 pDONR223 100% 70.5% 72% None (many diffs) n/a
2 ccsbBroad304_01593 pLX_304 0% 70.5% 72% V5 (many diffs) n/a
3 TRCN0000469867 GCGAAGCAAAGATTAAGTCCGACC pLX_317 35.7% 70.5% 72% V5 (many diffs) n/a
Download CSV