Transcript: Mouse NM_009506.2

Mus musculus vascular endothelial growth factor C (Vegfc), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Vegfc (22341)
Length:
1881
CDS:
248..1495

Additional Resources:

NCBI RefSeq record:
NM_009506.2
NBCI Gene record:
Vegfc (22341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328138 CAGACAAGTTCATTCAATTAT pLKO_005 889 CDS 100% 15.000 21.000 N Vegfc n/a
2 TRCN0000066922 CCAACAAACTATGTGTGGAAT pLKO.1 965 CDS 100% 4.950 6.930 N Vegfc n/a
3 TRCN0000328139 ATTTGCTGCTGCACATTATAA pLKO_005 559 CDS 100% 15.000 10.500 N Vegfc n/a
4 TRCN0000328140 TGAAGAACTGTTGCCACATTA pLKO_005 1532 3UTR 100% 13.200 9.240 N Vegfc n/a
5 TRCN0000328200 ACATCTGAACTAAGATCATAC pLKO_005 1483 CDS 100% 10.800 7.560 N Vegfc n/a
6 TRCN0000328141 ACCTCAGCAAGACGTTGTTTG pLKO_005 774 CDS 100% 10.800 7.560 N Vegfc n/a
7 TRCN0000066921 CCATCAAACATGCAGTTGTTA pLKO.1 1366 CDS 100% 5.625 3.938 N Vegfc n/a
8 TRCN0000066920 GCAGCCACAAACACCTTCTTT pLKO.1 671 CDS 100% 5.625 3.938 N Vegfc n/a
9 TRCN0000066919 CCCTAATTCATGTGGAGCCAA pLKO.1 1207 CDS 100% 2.640 1.848 N Vegfc n/a
10 TRCN0000066918 CCCAAGTCTGTGTTTATTGAA pLKO.1 1600 3UTR 100% 5.625 3.375 N Vegfc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07127 pDONR223 100% 86.7% 85.2% None (many diffs) n/a
2 ccsbBroad304_07127 pLX_304 53.7% 86.7% 85.2% V5 (many diffs) n/a
3 TRCN0000468000 AACGAGCTTTAACTCGGGGGACCG pLX_317 38.7% 86.7% 85.2% V5 (many diffs) n/a
Download CSV