Transcript: Mouse NM_009584.4

Mus musculus DnaJ heat shock protein family (Hsp40) member C2 (Dnajc2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dnajc2 (22791)
Length:
2037
CDS:
114..1979

Additional Resources:

NCBI RefSeq record:
NM_009584.4
NBCI Gene record:
Dnajc2 (22791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009584.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008554 CGGGCATTTAACAGTGTAGAT pLKO.1 576 CDS 100% 4.950 6.930 N Dnajc2 n/a
2 TRCN0000365853 AGAAGATGATCTGCAATTATT pLKO_005 1478 CDS 100% 15.000 10.500 N Dnajc2 n/a
3 TRCN0000374114 ATGGGAAGTCATTGCTAATTA pLKO_005 1541 CDS 100% 15.000 10.500 N Dnajc2 n/a
4 TRCN0000374113 GAACTGCCAAAGATGTTATTA pLKO_005 1594 CDS 100% 15.000 10.500 N Dnajc2 n/a
5 TRCN0000254055 ACAGATCAAAGCAGCTCATAA pLKO_005 428 CDS 100% 13.200 9.240 N DNAJC2 n/a
6 TRCN0000374143 ACAGATCAAAGCAGCTCATAA pLKO_005 428 CDS 100% 13.200 9.240 N Dnajc2 n/a
7 TRCN0000365925 CAATGAGGCAGACCGTGTTAA pLKO_005 1217 CDS 100% 13.200 9.240 N Dnajc2 n/a
8 TRCN0000254057 TACTTCACTTGCATAACTAAA pLKO_005 522 CDS 100% 13.200 9.240 N DNAJC2 n/a
9 TRCN0000365966 TACTTCACTTGCATAACTAAA pLKO_005 522 CDS 100% 13.200 9.240 N Dnajc2 n/a
10 TRCN0000008553 CAACAGAAGAACAGAAACTTT pLKO.1 1777 CDS 100% 5.625 3.938 N Dnajc2 n/a
11 TRCN0000008556 CCCAAAGATTGGAAGAATCAA pLKO.1 354 CDS 100% 5.625 3.938 N Dnajc2 n/a
12 TRCN0000011449 GCAATGGTCTTGAAACATCAT pLKO.1 450 CDS 100% 4.950 3.465 N Dnajc2 n/a
13 TRCN0000008555 GCTTGAATGAAATCCTGGCTT pLKO.1 1294 CDS 100% 2.640 1.848 N Dnajc2 n/a
14 TRCN0000151590 GAGAAAGAAGAGGAAGAAGAT pLKO.1 1086 CDS 100% 4.950 2.970 N SAMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009584.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11836 pDONR223 100% 23.8% 21.5% None (many diffs) n/a
2 ccsbBroad304_11836 pLX_304 0% 23.8% 21.5% V5 (many diffs) n/a
3 TRCN0000467850 GACATATCATTCCATTGCGATCGT pLX_317 84.2% 23.8% 21.5% V5 (many diffs) n/a
Download CSV