Transcript: Mouse NM_009715.3

Mus musculus activating transcription factor 2 (Atf2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Atf2 (11909)
Length:
4203
CDS:
447..1790

Additional Resources:

NCBI RefSeq record:
NM_009715.3
NBCI Gene record:
Atf2 (11909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082078 GCGAGCTAACTTGTACTTATT pLKO.1 2782 3UTR 100% 13.200 18.480 N Atf2 n/a
2 TRCN0000218996 GCTATCATACTGCTGATAAAG pLKO_005 1555 CDS 100% 1.320 1.848 N ATF2 n/a
3 TRCN0000082082 CTGGCTATCATACTGCTGATA pLKO.1 1552 CDS 100% 0.495 0.693 N Atf2 n/a
4 TRCN0000374123 ATCGTTCGTCCAGCATCATTA pLKO_005 759 CDS 100% 13.200 10.560 N Atf2 n/a
5 TRCN0000219047 TGCGAAATCTGTGGTTGTAAA pLKO_005 1870 3UTR 100% 13.200 10.560 N ATF2 n/a
6 TRCN0000374121 TGCGAAATCTGTGGTTGTAAA pLKO_005 1870 3UTR 100% 13.200 10.560 N Atf2 n/a
7 TRCN0000365860 ATGGTAGTCTTGTTATCATTT pLKO_005 2169 3UTR 100% 13.200 9.240 N Atf2 n/a
8 TRCN0000365933 GAAGTTTCTAGAACGAAATAG pLKO_005 1340 CDS 100% 13.200 9.240 N Atf2 n/a
9 TRCN0000013713 GCGAAATCTGTGGTTGTAAAT pLKO.1 1871 3UTR 100% 13.200 9.240 N ATF2 n/a
10 TRCN0000365934 TTGCTATTCCTGCATCAATTA pLKO_005 958 CDS 100% 13.200 9.240 N Atf2 n/a
11 TRCN0000013715 CCATCCTCTAACAGGCCAATT pLKO.1 876 CDS 100% 10.800 7.560 N ATF2 n/a
12 TRCN0000374043 TTCCTGTACCAGGCCCATTTC pLKO_005 898 CDS 100% 10.800 7.560 N Atf2 n/a
13 TRCN0000082079 CCGTTGCTATTCCTGCATCAA pLKO.1 955 CDS 100% 4.950 3.465 N Atf2 n/a
14 TRCN0000082080 CCTCCAGTTACCAATGGTGAT pLKO.1 1131 CDS 100% 4.050 2.835 N Atf2 n/a
15 TRCN0000082081 GCAGCTAATGAAGATCCTGAT pLKO.1 1308 CDS 100% 4.050 2.835 N Atf2 n/a
16 TRCN0000013714 GCATCATTACAGGTTCCCAAT pLKO.1 771 CDS 100% 4.050 2.835 N ATF2 n/a
17 TRCN0000013717 GCTCATAAAGATTGCCCTGTA pLKO.1 1512 CDS 100% 4.050 2.430 N ATF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00361 pDONR223 100% 83.1% 86.1% None (many diffs) n/a
2 ccsbBroad304_00361 pLX_304 44.6% 83.1% 86.1% V5 (many diffs) n/a
3 TRCN0000469368 TCGCTTTTGTCGAGAGAGTTTCCG pLX_317 30.8% 83.1% 86.1% V5 (many diffs) n/a
4 ccsbBroadEn_10749 pDONR223 100% 28.3% 28.3% None (many diffs) n/a
5 ccsbBroad304_10749 pLX_304 0% 28.3% 28.3% V5 (many diffs) n/a
6 TRCN0000468300 CCCGGTGGTGACCGCTCCGGTCGA pLX_317 57.9% 28.3% 28.3% V5 (many diffs) n/a
Download CSV