Transcript: Mouse NM_009794.3

Mus musculus calpain 2 (Capn2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Capn2 (12334)
Length:
3205
CDS:
130..2232

Additional Resources:

NCBI RefSeq record:
NM_009794.3
NBCI Gene record:
Capn2 (12334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030669 GCGGTCAGATACCTTCATTAA pLKO.1 1509 CDS 100% 13.200 18.480 N Capn2 n/a
2 TRCN0000308764 GCGGTCAGATACCTTCATTAA pLKO_005 1509 CDS 100% 13.200 18.480 N Capn2 n/a
3 TRCN0000030670 CCGTCTGGAAACGCTATTCAA pLKO.1 2130 CDS 100% 5.625 7.875 N Capn2 n/a
4 TRCN0000308763 CCGTCTGGAAACGCTATTCAA pLKO_005 2130 CDS 100% 5.625 7.875 N Capn2 n/a
5 TRCN0000030672 CGACGAGCTAATCATCGACTT pLKO.1 2085 CDS 100% 4.050 5.670 N Capn2 n/a
6 TRCN0000308847 CGACGAGCTAATCATCGACTT pLKO_005 2085 CDS 100% 4.050 5.670 N Capn2 n/a
7 TRCN0000030671 GCCAAGATCAATGGGTGCTAT pLKO.1 685 CDS 100% 4.950 3.960 N Capn2 n/a
8 TRCN0000308766 GCCAAGATCAATGGGTGCTAT pLKO_005 685 CDS 100% 4.950 3.960 N Capn2 n/a
9 TRCN0000030673 CCCTCACCTTGAATGAGGAAA pLKO.1 467 CDS 100% 0.495 0.347 N Capn2 n/a
10 TRCN0000308765 CCCTCACCTTGAATGAGGAAA pLKO_005 467 CDS 100% 0.495 0.347 N Capn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05933 pDONR223 100% 87.6% 94% None (many diffs) n/a
2 ccsbBroad304_05933 pLX_304 0% 87.6% 94% V5 (many diffs) n/a
3 TRCN0000474952 CGCGGTCGACCAGAGTATGATTGG pLX_317 20.8% 87.6% 94% V5 (many diffs) n/a
Download CSV